Phylogeny and functional conservation of σE in endospore-forming bacteria The GenBank accession numbers for the sequences determined in this work are AF225461–AF225466.

Arcuri, Edna Froeder; Boor, Kathryn J.

doi:10.1099/00221287-146-7-1593

Cited by 15 publications

(11 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The 824(pTSEG) results, especially, suggest that plasmid-borne expression of the spoIIGA-sigE-sigG operon disrupts normal sporulation, even though the spoIIGA-sigE-sigG operon was transcribed from its natural promoter and the plasmid was present at a low copy number. Previously, it was shown in B. subtilis that plasmid complementation of sigE mutants greatly reduced sporulation efficiency to 0.2% that of wild-type (WT) B. subtilis (2), and similar results were reported for plasmid complementation of a C. perfringens sigE mutant (12). Thus, even better-characterized hosts, such as B. subtilis, demonstrate a significant deviation in sporulation control when sigma factors are expressed from a replicating plasmid.…”

Section: Resultssupporting

confidence: 53%

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

2011

View full text Add to dashboard Cite

Central to all clostridia is the orchestration of endospore formation (i.e., sporulation) and, specifically, the roles of differentiation-associated sigma factors. Moreover, there is considerable applied interest in understanding the roles of these sigma factors in other stationary-phase phenomena, such as solvent production (i.e., solventogenesis). Here we separately inactivated by gene disruption the major sporulation-specific sigma factors, E and G , and performed an initial analysis to elucidate their roles in sporulation-related morphogenesis and solventogenesis in Clostridium acetobutylicum. The terminal differentiation phenotype for the sigE inactivation mutant stalled in sporulation prior to asymmetric septum formation, appeared vegetative-like often with an accumulation of DNA at both poles, frequently exhibited two longitudinal internal membranes, and did not synthesize granulose. The sigE inactivation mutant did produce the characteristic solvents (i.e., butanol and acetone), but the extent of solventogenesis was dependent on the physiological state of the inoculum. The sigG inactivation mutant stalled in sporulation during endospore maturation, exhibiting engulfment and partial cortex and spore coat formation. Lastly, the sigG inactivation mutant did produce granulose and exhibited wild-type-like solventogenesis.

show abstract

Section: Resultssupporting

confidence: 53%

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

2011

View full text Add to dashboard Cite

show abstract

“…The signature sequence - 5′TTTAATTCGAAGCAACGCGAAGAACCTTA3′ - shared by all the Clusters except 5 and 7 also indicates that these sequences may have a common origin similar to Lactobacillus , Paenibacillus , Clostridium , rumen bacterium, etc. [105]. Each of the clusters has certain unique signatures, which did not match with the 10 Bacillus spp.…”

Section: Resultsmentioning

confidence: 99%

Phylogeny in Aid of the Present and Novel Microbial Lineages: Diversity in Bacillus

et al. 2009

View full text Add to dashboard Cite

Bacillus represents microbes of high economic, medical and biodefense importance. Bacillus strain identification based on 16S rRNA sequence analyses is invariably limited to species level. Secondly, certain discrepancies exist in the segregation of Bacillus subtilis strains. In the RDP/NCBI databases, out of a total of 2611 individual 16S rDNA sequences belonging to the 175 different species of the genus Bacillus, only 1586 have been identified up to species level. 16S rRNA sequences of Bacillus anthracis (153 strains), B. cereus (211 strains), B. thuringiensis (108 strains), B. subtilis (271 strains), B. licheniformis (131 strains), B. pumilus (83 strains), B. megaterium (47 strains), B. sphaericus (42 strains), B. clausii (39 strains) and B. halodurans (36 strains) were considered for generating species-specific framework and probes as tools for their rapid identification. Phylogenetic segregation of 1121, 16S rDNA sequences of 10 different Bacillus species in to 89 clusters enabled us to develop a phylogenetic frame work of 34 representative sequences. Using this phylogenetic framework, 305 out of 1025, 16S rDNA sequences presently classified as Bacillus sp. could be identified up to species level. This identification was supported by 20 to 30 nucleotides long signature sequences and in silico restriction enzyme analysis specific to the 10 Bacillus species. This integrated approach resulted in identifying around 30% of Bacillus sp. up to species level and revealed that B. subtilis strains can be segregated into two phylogenetically distinct groups, such that one of them may be renamed.

show abstract

“…It was speculated that, as with the C. acetobutylicum EKO1 and GKO1 mutants (sigE and sigG disruption mutants, respectively), plasmid-based complementation would not restore sporulation (54). In B. subtilis, plasmid complementation of a sigE mutant failed to restore WT levels of sporulation, and only by integrating the operon back onto the chromosome could WT levels of sporulation be restored (2). Although no equivalent B. subtilis study with a sigF mutant could be identified in the literature, it is possible that this is the case for sigF mutants as well.…”

Section: Disruption Of Sigfmentioning

confidence: 99%

Inactivation of σ ^F in Clostridium acetobutylicum ATCC 824 Blocks Sporulation Prior to Asymmetric Division and Abolishes σ ^E and σ ^G Protein Expression but Does Not Block Solvent Formation

et al. 2011

View full text Add to dashboard Cite

Clostridium acetobutylicum is both a model organism for the understanding of sporulation in solventogenic clostridia and its relationship to solvent formation and an industrial organism for anaerobic acetone-butanolethanol (ABE) fermentation. How solvent production is coupled to endospore formation-both stationaryphase events-remains incompletely understood at the molecular level. Specifically, it is unclear how sporulation-specific sigma factors affect solvent formation. Here the sigF gene in C. acetobutylicum was successfully disrupted and silenced. Not only F but also the sigma factors E and G were not detected in the sigF mutant (FKO1), and differentiation was stopped prior to asymmetric division. Since plasmid expression of the spoIIA operon (spoIIAA-spoIIAB-sigF) failed to complement FKO1, the operon was integrated into the FKO1 chromosome to generate strain FKO1-C. In FKO1-C, F expression was restored along with sporulation and E and G protein expression. Quantitative reverse transcription-PCR (RT-PCR) analysis of a select set of genes (csfB, gpr, spoIIP, sigG, lonB, and spoIIR) that could be controlled by F , based on the Bacillus subtilis model, indicated that sigG may be under the control of F , but spoIIR, an important activator of E in B. subtilis, is not, and neither are the rest of the genes investigated. FKO1 produced solvents at a level similar to that of the parent strain, but solvent levels were dependent on the physiological state of the inoculum. Finally, the complementation strain FKO1-C is the first reported instance of purposeful integration of multiple functional genes into a clostridial chromosome-here, the C. acetobutylicum chromosome-with the aim of altering cell metabolism and differentiation.The endospore-forming obligate anaerobe Clostridium acetobutylicum is best known for its acetone, butanol, and ethanol (ABE) fermentation and has recently received renewed attention for of its industrial potential, specifically as a biofuel producer (26,37). Despite this increased attention and potential, many fundamental questions remain about clostridial physiology, differentiation, and metabolism, and the lack of this basic knowledge has limited the success of engineering of C. acetobutylicum for industrial processes (26, 37). Two of these key questions are how clostridial cells regulate differentiation and how differentiation is related to solvent formation (26,37,38). It has been well established that Spo0A is the master regulator of both solventogenesis and sporulation (8,14,41), but the regulation of sporulation downstream of Spo0A and any effect the regulation has on solventogenesis are not yet well understood (37,38).In contrast, sporulation in Bacillus subtilis has been studied extensively, and its regulation is well understood (9,16,48). To initiate sporulation, B. subtilis employs a multicomponent phosphorelay to phosphorylate Spo0A (4, 40), which then stimulates the expression of sigF, the prespore-specific sigma factor, and sigE, the mother cell-specific sigma factor (9, 16), in add...

show abstract

Phylogeny and functional conservation of σE in endospore-forming bacteria The GenBank accession numbers for the sequences determined in this work are AF225461–AF225466.

Abstract: Conservation of the sporulation processes between

Cited by 15 publications

References 41 publications

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Phylogeny in Aid of the Present and Novel Microbial Lineages: Diversity in Bacillus

Inactivation of σ ^F in Clostridium acetobutylicum ATCC 824 Blocks Sporulation Prior to Asymmetric Division and Abolishes σ ^E and σ ^G Protein Expression but Does Not Block Solvent Formation

Contact Info

Product

Resources

About

Phylogeny and functional conservation of σE in endospore-forming bacteria The GenBank accession numbers for the sequences determined in this work are AF225461–AF225466.

Abstract: Conservation of the sporulation processes between

Cited by 15 publications

References 41 publications

Inactivation of σ E and σ G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Inactivation of σ E and σ G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Phylogeny in Aid of the Present and Novel Microbial Lineages: Diversity in Bacillus

Inactivation of σ F in Clostridium acetobutylicum ATCC 824 Blocks Sporulation Prior to Asymmetric Division and Abolishes σ E and σ G Protein Expression but Does Not Block Solvent Formation

Contact Info

Product

Resources

About

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Inactivation of σ ^E and σ ^G in Clostridium acetobutylicum Illuminates Their Roles in Clostridial-Cell-Form Biogenesis, Granulose Synthesis, Solventogenesis, and Spore Morphogenesis

Inactivation of σ ^F in Clostridium acetobutylicum ATCC 824 Blocks Sporulation Prior to Asymmetric Division and Abolishes σ ^E and σ ^G Protein Expression but Does Not Block Solvent Formation