Phylogenetic Relationship of the Complete Rauscher Murine Leukemia Virus Genome with Other Murine Leukemia Virus Genomes

Abstract

We report the complete nucleotide sequence of the genome of Rauscher murine leukemia virus (R-MuLV), the replication-competent helper virus present in the Rauscher virus complex, and its phylogenetic relationship with other murine leukemia virus genomes. An overall sequence identity of 97.6% was found between R-MuLV and the Friend helper virus (F-MuLV), and the two viruses were closely related on the phylogenetic trees constructed from either gag, pol, or env sequences. Moloney murine leukemia virus (Mo-MuLV) was the next closest relative to R-MuLV and F-MuLV on all trees, followed by Akv and radiation leukemia virus (RadLV). The most distantly related helper virus was Hortulanus murine leukemia virus (Ho-MuLV). Interestingly, Cas-Br-E branched with Mo-MuLV on the gag and pol trees, whereas on the env tree, it revealed the highest degree of relatedness to Ho-MuLV, possibly due to an ancient recombination with an Ho-MuLV ancestor. In summary, a phylogenetic analysis involving various MuLVs has been performed, in which the postulated close relationship between R-MuLV and F-MuLV has been confirmed, consistent with the pathobiology of the two viruses.

Characterization of a Novel Murine Retrovirus Mixture That Facilitates Hematopoiesis

“…To clone the env gene of MuLV produced by the endogenous locus Bxv1, the same RNA was used to prepare cDNA by using SuperScript II reverse transcriptase in the buffer supplied by the manufacturer (GIBCO BRL) and a deoxythymine (15) primer (Promega Biotec, Inc., Madison, Wis.). The cDNAs were then amplified by PCR with forward primer 5ЈCCGAGTCGGTGACACAGTGTG3Ј (nucleotides [nt] 5589 to 55609 within the pol gene according to the Rauscher MuLV numbering) (28) and reverse primer 5ЈCATTCCCCCCTTTTTCTGGAAACT3Ј (nt 7845 to 7822 within the env gene according to the Rauscher MuLV numbering) (28). The PCR products were size fractionated on 1% agarose gels, purified, and cloned into the SrfI site of pCRScript according to the manufacturer's protocol (Stratagene, Inc., La Jolla, Calif.).…”