p190A RhoGAP induces CDH1 expression and cooperates with E-cadherin to activate LATS kinases and suppress tumor cell growth

OuYang, Han-Yue; Luong, Phi; Frödin, Morten; Hansen, Steen Ingemann

doi:10.1038/s41388-020-1385-2

Cited by 13 publications

(21 citation statements)

References 68 publications

(86 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…With the in-depth study of epigenetics and proteomics, the normal expression of genes can be disturbed through DNA methylation, histone modification, chromatin remodeling, and noncoding RNA regulation, thereby affecting the transcription and expression of related genes. Oncogene activation and tumor suppressor gene deletion 18,19 have received extensive attention in cancer research in recent years. In most cases, oncogenes are considered important factors in the occurrence and development of NPC.…”

Section: Discussionmentioning

confidence: 99%

Expression and Biological Functions of EPC1 in Nasopharyngeal Carcinoma

et al. 2021

View full text Add to dashboard Cite

Background: Comb homolog enhancer 1 (EPC1) gene is one of the important members of epigenetic inhibitor PCG family. It shows carcinogenic potential in a variety of malignant tumors, but the expression and role of EPC1 in nasopharyngeal carcinoma are unclear. The aim of this study was to explore the expression and function of enhancer of polycomb homolog 1 (EPC1) in nasopharyngeal carcinoma (NPC). Methods: The differential expression of EPC1 in the cancer tissues and cell lines of NPC was examined by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). EPC1 expression, cell proliferation, and apoptosis were detected in NPC cell lines after EPC1 silencing, and the levels of the epithelial-mesenchymal transition (EMT)-related proteins E-cadherin and vimentin were detected in NPC cells after EPC1 silencing. The study was performed at Fujian Provincial Hospital, Fujian, China, from 2018 to 2019. Results: We found that EPC1 was significantly upregulated in the cancer tissues and cell lines of NPC (P<0.001). Furthermore, knockdown of EPC1 inhibited the growth and metastasis of NPC cells. E-cadherin and vimentin were detected in NPC cells after EPC1 was knocked out. It was confirmed that inhibition of EPC1 resulted in increased E-cadherin expression (P<0.001) and decreased vimentin expression (P<0.001), suggesting that inhibition of EPC1 could inhibit the EMT in NPC cells. Conclusion: EPC1 expression was upregulated in NPC tissues and cell lines. Knockout of EPC1 effectively inhibited the growth of NPC cells, induced apoptosis, and inhibited invasion and metastasis. Inhibition of EPC1 could inhibit the EMT in NPC cells. All of the above findings support the viewpoint that EPC1 plays a pro-cancer role in NPC.

show abstract

Section: Discussionmentioning

confidence: 99%

Expression and Biological Functions of EPC1 in Nasopharyngeal Carcinoma

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Direct contact between normal cells activates the Hippo kinases, thus leading to phosphorylation and cytoplasmic retention of YAP/TAZ, triggering cell cycle arrest and/or autophagy ( Pavel et al, 2018 ). In contrast, hypophosphorylation and nuclear localization of YAP/TAZ have been associated with loss of contact inhibition of cancer cells resulting from somatic mutations ( Zhao et al, 2007 ; Zhang et al, 2010 ; Tranchant et al, 2017 ; Frank et al, 2018 ; Ouyang et al, 2020 ).…”

Section: Yap and Taz Are At The Center Stage Of Mechanotransductionmentioning

confidence: 99%

Mechanoregulation of YAP and TAZ in Cellular Homeostasis and Disease Progression

Cai

Wang

Meng

2021

Front. Cell Dev. Biol.

126

118

View full text Add to dashboard Cite

Biophysical cues, such as mechanical properties, play a critical role in tissue growth and homeostasis. During organ development and tissue injury repair, compressive and tensional forces generated by cell-extracellular matrix or cell-cell interaction are key factors for cell fate determination. In the vascular system, hemodynamic forces, shear stress, and cyclic stretch modulate vascular cell phenotypes and susceptibility to atherosclerosis. Despite that emerging efforts have been made to investigate how mechanotransduction is involved in tuning cell and tissue functions in various contexts, the regulatory mechanisms remain largely unknown. One of the challenges is to understand the signaling cascades that transmit mechanical cues from the plasma membrane to the cytoplasm and then to the nuclei to generate mechanoresponsive transcriptomes. YAP and its homolog TAZ, the Hippo pathway effectors, have been identified as key mechanotransducers that sense mechanical stimuli and relay the signals to control transcriptional programs for cell proliferation, differentiation, and transformation. However, the upstream mechanosensors for YAP/TAZ signaling and downstream transcriptome responses following YAP/TAZ activation or repression have not been well characterized. Moreover, the mechanoregulation of YAP/TAZ in literature is highly context-dependent. In this review, we summarize the biomechanical cues in the tissue microenvironment and provide an update on the roles of YAP/TAZ in mechanotransduction in various physiological and pathological conditions.

show abstract

“…Thus, RNA was isolated with the High Pure RNA Isolation Kit (Hoffmann‐La Roche, CH), following the manufacture’s protocol, and cDNA was synthesized using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Real-time PCR with the primers COL1A2 , DDR2 , PDGFRα , POSTN , αSMA , TGF-β1 , VIM , FN-EDA and MYH10 was performed for quantifying the mRNA expression levels with respect to GAPDH levels as it was previously described ( COL1A2 (Accession number: NM_000089.3) 65 : F‐TCGCACATGCCGTGACTTG; R‐GATAGCATCCATAGTGCATCCTTG, DDR2 (Accession number: NM_001014796.3) 66 : F‐AACGAGAGTGCCACCAATGGCT; R‐ACTCACTGGCTTCAGAGCGGAA, PDGFRα (Accession number: NM_001347830.2) 67 : F‐GACTTTCGCCAAAGTGGAGGAG; R‐AGCCACCGTGAGTTCAGAACGC, POSTN (Accession number: NM_001135935.2) 67 : F‐CGTTGCTCTCCAAACCTCTA; R‐TGCCCAGCAGTTTTGCCCAT, αSMA (Accession number: NM_001613.4) 68 : F‐CCGACCGAATGCAGAAGGA; R‐ACAGAGTATTTGCGCTCCGAA, TGF-β1 (Accession number: NM_000660.7) 69 : F‐TACCTGAACCCGTGTTGCTCTC; R-GTTGCTGAGGTATCGCCAGGAA, VIM (Accession number: NM_003380.5) 70 : F‐AGGCAAAGCAGGAGTCCACTGA; R-ATCTGGCGTTCCAGGGACTCAT, FN-EDA (Accession number: NM_002026.4) 71 : F- CCAGTCCACAGCTATTCCTG ; R-ACAACCACGGATGAGCTG, MYH10 (Accession number: NM_001256095.2) 72 : F- TCCCGCTGGAGTTTACGC ; R-GCAGGAAGCCAAGGAACG and GAPDH (Accession number: NM_001357943.2) 73 : F‐CATGTTCGTCATGGGGTGAACCA; R‐AGTGATGGCATGGACTGTGGTCAT).…”

Section: Methodsmentioning

confidence: 99%

Relaxin-2 plasma levels in atrial fibrillation are linked to inflammation and oxidative stress markers

Aragón-Herrera

Couselo‐Seijas

Feijóo‐Bandín

et al. 2022

Sci Rep

View full text Add to dashboard Cite

Relaxin-2 exerts many favourable cardiovascular effects in pathological circumstances such as atrial fibrillation (AF) and heart failure, but the mechanisms underlying its actions are not completely understood. Since inflammation and fibrosis are pivotal processes in the pathogenesis of AF, our aim was to study the relationship between relaxin-2 plasma levels in left atrium (LA) and peripheral vein with molecules implicated in fibrosis, inflammation and oxidative stress in AF patients, and to evaluate the anti-fibrotic ability of relaxin-2 in normal human atrial cardiac fibroblasts (NHCF-A). Peripheral vein relaxin-2 plasma levels were higher than LA relaxin-2 plasma levels in men while, in women, peripheral vein relaxin-2 levels were increased compared to men. AF patients with higher levels of relaxin-2 exhibited a reduction in H2O2 plasma levels and in mRNA levels of alpha-defensin 3 (DEFA3) and IL-6 in leucocytes from LA plasma. Relaxin-2-in-vitro treatment inhibited NHCF-A migration and decreased mRNA and protein levels of the pro-fibrotic molecule transforming growth factor-β1 (TGF-β1). Our results support an association between relaxin-2 and molecules involved in fibrosis, inflammation and oxidative stress in AF patients, and reinforce an anti-fibrotic protective role of this hormone in NHCF-A; strengthening the relevance of relaxin-2 in AF physiopathology, diagnosis and treatment.

show abstract

p190A RhoGAP induces CDH1 expression and cooperates with E-cadherin to activate LATS kinases and suppress tumor cell growth

Cited by 13 publications

References 68 publications

Expression and Biological Functions of EPC1 in Nasopharyngeal Carcinoma

Expression and Biological Functions of EPC1 in Nasopharyngeal Carcinoma

Mechanoregulation of YAP and TAZ in Cellular Homeostasis and Disease Progression

Relaxin-2 plasma levels in atrial fibrillation are linked to inflammation and oxidative stress markers

Contact Info

Product

Resources

About