Overexpression of CCN1 in Het1A cells attenuates bile-induced esophageal metaplasia through suppressing non-canonical NFκB activation

Dang, Tong; Meng, Xiemei; Modak, Cristina; Wu, Jinbao; Chang, Zhiheng; Che, Na; Narvaez, Reinier; Chai, Jianyuan

doi:10.1016/j.cyto.2018.12.020

Cited by 10 publications

(9 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Four hundred nanograms of total RNA was converted to cDNA using a RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Fisher Scientific). Quantitative PCR was performed to examine expression of ADAM9 mRNA in a 20‐μl volume of the reaction mixture, containing 5 μl of cDNA, 10 μM of each forward and reverse primer for ADAM9 (forward: CTTGCTGCGAAGGAAGTACCTG; reverse: CACTCACTGGTTTTTCCTCGGC), tumor necrosis factor‐alpha ( TNFα ) (forward: TTCTGCCTGCTGCACTTTGGA; reverse: TTGATGGCAGAGAGGAGGTTG) [26], TNF receptor superfamily member 1A ( TNFRSF1A ) (forward: CCGCTTCAGAAAACCACCTCAG; reverse: ATGCCGGTACTGGTTCTTCCTG) [27], or TNF receptor superfamily member 1B ( TNFRSF1B ) (forward: CGTTCTCCAACACGACTTCATCC; reverse: ACGTGCAGACTGCATCCATGCT) [27], and 10 μl of the SensiFAST SYBR No‐ROX Master Mix (Bioline). The PCR was conducted for 40 cycles, each at 95°C for 20 s, at 60°C for 20 s, and at 72°C for 25 s, in a LightCycler 480 instrument (Roche Molecular Biochemicals).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Involvement of the A disintegrin and metalloproteinase 9 in oral cancer cell invasion

Buranaphatthana

Makeudom

et al. 2021

European J Oral Sciences

View full text Add to dashboard Cite

The aims of this study were to determine the functional roles of the transmembrane glycoprotein, Disintegrin and metalloproteinase domain-containing protein 9 (ADAM 9), in the phosphorylation of epidermal growth factor receptor (EGFR) and AKT and in the aggressiveness of oral cancer cells. Immunohistochemistry and immunoblotting were conducted to determine expression of ADAM 9 and the levels of EGFR phosphorylated at the tyrosine 1173 residue (p-EGFR tyr1173 ) and AKT phosphorylated at the serine 473 residue (p-AKT ser473 ) in oral cancer tissues and in the oral cancer cell lines HN5, HN6, HN15, and HN008. Small interfering RNA (siRNA) was used to inhibit expression of ADAM9 mRNA, and thus production of ADAM9 protein, in oral cancer cells. ADAM9-knockdown cells were examined for p-EGFR tyr1173 and p-AKT ser473 levels and used for cell proliferation and invasion assays. A positive correlation among overexpression of ADAM 9, p-EGFR tyr1173 , and p-AKT ser473 was found in oral cancer tissues.

show abstract

Section: Methodsmentioning

confidence: 99%

“…reverse: ACGTGCAGACTGCATCCATGCT) [27], and 10 μl of the SensiFAST SYBR No-ROX Master Mix (Bioline). The PCR was conducted for 40 cycles, each at 95°C for 20 s, at 60°C for 20 s, and at 72°C for 25 s, in a LightCycler 480 instrument (Roche Molecular Biochemicals).…”

Section: Total Rna Isolation and Rt-qpcrmentioning

confidence: 99%

Involvement of the A disintegrin and metalloproteinase 9 in oral cancer cell invasion

Buranaphatthana

Makeudom

et al. 2021

European J Oral Sciences

View full text Add to dashboard Cite

show abstract

“…Current studies have shown that CYR61 plays an important role in lung disease, kidney disease, cardiovascular disease, liver disease, and other diseases (16,(36)(37)(38). The mechanisms of its action are also varied, such as direct activation of toll-like receptor signal (39), activation of the PTEN/Akt/GSK3β/CyclinD1 signaling pathway (40), regulation of DCK and CTGF (41), inhibition of CD40 and its proteins related to non-canonical signaling (42), and so on. The complexity of its downstream pathways also indicates the complexity of its physiological and pathological effects, which is consistent with the phenomenon that the up-regulation of CYR61 may play different roles in the inflammation of different tissues.…”

Section: Discussionmentioning

confidence: 99%

CYR61, regulated by miR-22-3p and MALAT1, promotes autophagy in HK-2 cell inflammatory model

Guo¹,

Ma²,

Deng³

et al. 2021

Transl Androl Urol

View full text Add to dashboard Cite

Background: Renal tubular epithelial cells play an important role in renal function and are a major site of injury from inflammation. Emerging evidence suggests that CYR61 is involved in the regulation of autophagy. However, there are few studies on CYR61 in nephropathy and associated inflammation.This study aimed to clarify how CYR61 regulates autophagy in human renal epithelial cells while in an inflammatory state and regulates the upstream pathway of CYR61 levels. Methods: The human renal tubular epithelial cells (HK-2) cell line treated by lipopolysaccharide (LPS) was used as an inflammatory model of human epithelial cells. Short hairpin RNA (shRNA) was used to down-regulate CYR61, and the changes in the transcription and expression levels of related molecules, as well as the morphological changes of HK-2 cells, were detected by quantitative real time-PCR (qRT-PCR), western blot (WB), and transmission electron microscopy. Either CYR61 or MALAT1 were up-regulated by overexpression vectors, or MALAT1 was down-regulated by miR-22-3p mimics. Subsequently, the levels of CYR61, MALAT1, related inflammatory factors, and autophagy factors were measured by qPCR, WB, and enzyme-linked immunosorbent assay (ELISA). Cell apoptosis was detected by flow cytometry and acridineorange assay. Results: We observed that down-regulation of CYR61 could down-regulate 1B-light chain 3 (LC3) level and inhibit autophagy in the LPS-induced inflammation model of HK-2 cells. The expression levels of CYR61, Beclin1, Atg5, LC3, interleukin 6 (IL-6), and tumor necrosis factor-α (TNF-α) were significantly increased by upregulating CYR61 or MALAT1 by overexpression vector, while the expression level of p62 was significantly decreased, intracellular reactive oxygen species (ROS) content was increased, and the proportion of autophagy and apoptosis was increased. The use of miR-22-3p mimics significantly reversed the changes induced by up-regulation of CYR61 or MALAT1 at the molecular and cellular levels.Conclusions: Our data indicated that CYR61 positively regulates autophagy of HK-2 cells under an inflammatory state, and was negatively regulated by miR-22-3p, while miR-22-3p and MALAT1 were negatively regulated by each other.

show abstract

“…The reaction was performed under the following conditions: an initial denaturation step at 95°C for 15 min, followed by 40 cycles of 94°C for 30 sec, annealing temperature (Table 3.1) for 30 sec, 72°C for 30 sec and then fluorescence was measured. The primers were purchased from Invitrogen and the sequences of the primers are listed in Table 2.1 [30][31][32][33][34][35][36][37][38][39][40]. Quantification of expressed gene as relative mRNA level compared with healthy control levels, was calculated after normalization to GAPDH according to Livak method (2 -ΔΔCt ) [41].…”

Section: Real-time Rt-pcr Assaymentioning

confidence: 99%

Diabetes Induced Renal Complications by Leukocyte Activation of Nuclear Factor κ-B and its Regulated Genes Expression

Darwish

Elnahas

AlQahtany

2020

Preprint

View full text Add to dashboard Cite

Type 2 diabetes mellitus (T2D) is a metabolic disorder characterized by inappropriate insulin function. Despite wide progress in genome studies, defects in gene expression for diabetes prognosis still incompletely identified. Prolonged hyperglycemia activates NF-κB, which is a main player in vascular dysfunctions of diabetes. Activated NF-κB, triggers expression of various genes that promote inflammation and cell adhesion process. Alteration of pro-inflammatory and profibrotic gene expression contribute to the irreversible functional and structural changes in the kidney resulting in diabetic nephropathy (DN). To identify the effect of some important NF-κB related genes on mediation of DN progression, we divided our candidate genes on the basis of their function exerted in bloodstream into three categories (Proinflammatory; NF-κB, IL-1B, IL-6, TNF-α and VEGF); (Profibrotic; FN, ICAM-1, VCAM-1) and (Proliferative; MAPK-1 and EGF). We analyzed their expression profile in leukocytes of patients and explored their correlation to diabetic kidney injury features. Our data revealed the overexpression of both proinflammatory and profibrotic genes in DN group when compared to T2D group and were associated positively with each other in DN group indicating their possible role in DN progression. In DN patients, increased expression of proinflammatory genes correlated positively with glycemic control and inflammatory markers indicating their role in DN progression. Our data revealed that the persistent activation NF-κB and its related genes observed in hyperglycemia might contribute to DN progression and might be a good diagnostic and therapeutic target for DN progression. Large-scale studies are needed to evaluate the potential of these molecules to serve as disease biomarkers.

show abstract

Overexpression of CCN1 in Het1A cells attenuates bile-induced esophageal metaplasia through suppressing non-canonical NFκB activation

Cited by 10 publications

References 36 publications

Involvement of the A disintegrin and metalloproteinase 9 in oral cancer cell invasion

Involvement of the A disintegrin and metalloproteinase 9 in oral cancer cell invasion

CYR61, regulated by miR-22-3p and MALAT1, promotes autophagy in HK-2 cell inflammatory model

Diabetes Induced Renal Complications by Leukocyte Activation of Nuclear Factor κ-B and its Regulated Genes Expression

Contact Info

Product

Resources

About