Oral Administration of Geranylgeraniol Rescues Denervation-induced Muscle Atrophy via Suppression of Atrogin-1

Abstract

Background/Aim: Geranylgeraniol (GGOH), a C20 isoprenoid naturally occurs in several foods. We previously reported that GGOH treatment reduced the expression levels of Atrogin-1 which is involved in skeletal muscle degradation and stimulates the myogenic differentiation of C2C12 myoblasts. However, the effect of GGOH supplementation on skeletal muscle metabolism in vivo is unknown. Materials and Methods: Skeletal muscle atrophy was induced by denervation. The expression levels of Atrogin-1 were assessed by western blotting or real time PCR. Results: Intraoral administration of GGOH reduced the decrease in the cross-sectional area of muscle fibers and also suppressed the expression levels of Atrogin-1 in denervation induced muscle atrophy. Also, GGOH treatment suppressed the expression of Atrogin-1 and the decrease in skeletal muscle fiber size by glucocorticoid in vitro. Conclusion: Intraoral administration of GGOH rescues denervation-induced muscle atrophy via suppression of Atrogin-1. Sarcopenia is an age-related decline in muscle strength and mass (1). Decreased muscle mass is often accompanied by increased insulin resistance. Sarcopenia has also various 2345 This article is freely accessible online.

The Role of Geranylgeraniol in Managing Bisphosphonate-Related Osteonecrosis of the Jaw

“…Being a central isoprenoid in the mevalonate pathway, GGOH is not only a substrate for the synthesis of menatetrenone/menaquinone-4 (MK-4) and a building block for CoQ10 ( Shirakawa et al, 2018 ), but also acts as an important intermediate for the prenylation of proteins by GTPases ( Shirakawa et al, 2018 ), providing the basis for its protective actions against bisphosphonate-related ONJ (BRONJ). Most recently, GGOH has been commercialized as a dietary supplement in the form of an extract from annatto, and is generally recognized as safe (GRAS) ( Miyawaki et al, 2020 ), opening the doors to potential clinical trials with the endogenous nutrient.…”

Natural Compounds Attenuate Denervation-Induced Skeletal Muscle Atrophy

“…Matsubara et al showed that GGOH enhances C2C12 myoblast differentiation in vitro, but high doses of GGOH tend to suppress myoblast proliferation [ 110 ]. Miyawaki et al reported that GGOH administration increased the muscle fiber size in denervation-induced skeletal muscle atrophy in vivo [ 111 ]. GGOH also suppresses the denervation-induced or glucocorticoid-induced atrogin-1 expression [ 111 ].…”

“…Miyawaki et al reported that GGOH administration increased the muscle fiber size in denervation-induced skeletal muscle atrophy in vivo [ 111 ]. GGOH also suppresses the denervation-induced or glucocorticoid-induced atrogin-1 expression [ 111 ]. Expression of atrogin-1 is increased when muscle atrophy is induced by the stressors [ 112 ].…”

Plectin Promotes Melanoma Tumor Formation by Regulation of Src Activity

“…Total RNA was isolated using FastGene TM RNA Basic Kit (Nippon Genetics, Tokyo, Japan) and reverse-transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) 44 . Real time qPCR was performed on a Quantstudio 3 (Thermo Fisher Scientific) with specific primers for murine Cyclin D1 (Ccnd1); (forward, 5'tttctttccagagtcatcaagtgt -3'; 5'-tgactccagaagggcttcaa -3'), human Cyclin D1 (CCND1); (forward, 5'-tctacaccgacaactccatccg -3'; 5'-tctggcattttggagaggaagtg -3'), human PLECTIN; (forward, 5'agcgtgagaaggagaagctcca -3'; 5'-cagagaggaagctttgctgcag -3'), murine β-actin; (forward, 5'-aaggccaaccgtgaaaagat -3'; reverse, 5'-gtggtacgaccagaggcatac -3'), and human β-actin; (forward, 5'-caccattggcaatgagcggttc -3'; reverse, 5'-aggtctttgcggatgtccacgt -3') 45,46 .…”

“…Total RNA was isolated using FastGene TM RNA Basic Kit (Nippon Genetics, Tokyo, Japan) and reverse-transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) 44 . Real time qPCR was performed on a Quantstudio 3 (Thermo Fisher 5'-caccattggcaatgagcggttc -3'; reverse, 5'-aggtctttgcggatgtccacgt -3') 45,46 .…”