Oral Abscess Caused by
            <i>Campylobacter rectus</i>
            : Case Report and Literature Review

Mahlen, Steven D.; Clarridge, Jill E.

doi:10.1128/jcm.01590-08

Cited by 34 publications

(34 citation statements)

References 19 publications

(15 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primers VAB1 (TGGAGAGTTTGATCCTGGCTCA), VAB2 (GTATTACCGCGGCTGCTGG), VAB3 (CCAGCAGCCG CGGTAATAC), VAB4 (CGGGACTTAACCCAACATCTC AC), VAB5 (GTGAGATGTTGGGTTAAGTCCCG), and VAB6 (AAGGAGGTGATCCAGCCGCA) were utilized to sequence a large portion of the 16S rRNA gene in five separate reactions in the following pair subsets: VAB-1/2, VAB-3/4, VAB-5/6, VAB-1/4, and VAB-3/6. PCR assays were performed as previously described (23). The resulting PCR products were cleaned with ExoSAP-IT (USB Products, Cleveland, OH) and sent to a core sequencing lab for cycle sequencing.…”

Section: Case Reportmentioning

confidence: 99%

Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

et al. 2011

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Case Reportmentioning

confidence: 99%

Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

et al. 2011

Self Cite

View full text Add to dashboard Cite

show abstract

“…The NCBI, Microseq, and BIBI databases were all used to search for comparison sequences, with all confirming the identification. Sequence analysis was performed using Microseq software as previously described (3,10).…”

mentioning

confidence: 99%

Thumb Infection Caused by Streptococcus pseudoporcinus

Mahlen

Clarridge

2009

J Clin Microbiol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Primers (synthesized by TIB Molbiol, Adelphia, NJ) VAB1 (5=-TGGAGAGTTTGATC CTGGCTCAG-3=) and VAB2 (5=-GTATTACCGCGGCTGCTGG-3=) were used to generate a 543-bp amplicon of the 16S rRNA gene. PCR was performed as previously described (9), and sequencing reactions were performed using the ABI Prism BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), with sequences generated using the Biosystems 3500 genetic analyzer, according to the manufacturer's instructions. The sequences were analyzed and compared to information in the BIBI and GenBank databases (10).…”

Section: Methodsmentioning

confidence: 99%

Clinical Significance and Characterization of Streptococcus tigurinus Isolates in an Adult Population

Bourassa

Clarridge

2015

J Clin Microbiol

View full text Add to dashboard Cite

Streptococcus tigurinus is a newly described member of the Streptococcus mitis group. Due to the difficulty in distinguishing viridans group streptococci (VGS) by phenotype, analysis of 16S rRNA sequences is necessary for the accurate identification of most species. Through a laboratory policy of analyzing all clinically significant isolates from the VGS group by16S rRNA gene sequencing, we identified 14 S. tigurinus isolates from 11 patients. The Vitek 2 system most commonly gave an excellent rating to an incorrect identification (e.g., Streptococcus mitis), as did matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) (e.g., Streptococcus oralis). S. tigurinus strains were recovered from numerous body sites, including the blood, peritoneal fluid, bone, synovial fluid, a perianal abscess, and an arm wound. Retrospective chart review indicated that most isolates were clinically significant, with bacteremia (n ‫؍‬ 5), soft tissue infections (n ‫؍‬ 3) osteomyelitis (n ‫؍‬ 2), infected joint prosthesis (n ‫؍‬ 2), and peritonitis (n ‫؍‬ 2) being the most common, thus expanding the spectrum of disease associated with S. tigurinus. Streptococcus tigurinus was first described after isolation from a patient with infective endocarditis. Isolates of alpha-hemolytic, catalase-negative Gram-positive cocci were recovered from multiple blood cultures of a 74-year-old patient. The isolates were initially identified as viridans group streptococci (VGS). However, analysis of 16S rRNA sequences revealed that the isolates were distinct members of the Streptococcus mitis group (SMG) and were closely related to Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus mitis, Streptococcus infantis, and Streptococcus oralis (1). This novel Streptococcus strain was named Streptococcus tigurinus. Since the first report of S. tigurinus infection in 2012, S. tigurinus has been isolated from several additional sterile sites, including cerebrospinal fluid, heart valves, and joint fluid (2, 3). It has been associated with serious invasive infections, including infective endocarditis, culture-negative endocarditis, spondylodiscitis, bacteremia, meningitis, prosthetic joint infections, and thoracic empyema (2, 4). Small colony variants of S. tigurinus were associated with a prosthetic joint infection (3). S. tigurinus has also been isolated from the subgingival plaque of a patient with periodontitis (5). In vitro studies have shown S. tigurinus to be highly virulent in a rat model of experimental endocarditis (6).Because of its relatedness to SMG, S. tigurinus has been hypothesized to be a commensal of the human oral cavity. Data to support this hypothesis, however, are conflicting (7). In a screen of saliva specimens from 31 volunteers, S. tigurinus was not identified among the more than 600 strains of alpha-hemolytic bacterial colonies isolated (2). In a second study that used a specific 16S rRNA gene real-time TaqMan PCR assay, however, S. tigurinus was detected in the saliva and subgingiv...

show abstract

Oral Abscess Caused by Campylobacter rectus : Case Report and Literature Review

Cited by 34 publications

References 19 publications

Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

Achromobacter xylosoxidans Infection Presenting as a Pulmonary Nodule Mimicking Cancer

Thumb Infection Caused by Streptococcus pseudoporcinus

Clinical Significance and Characterization of Streptococcus tigurinus Isolates in an Adult Population

Contact Info

Product

Resources

About