Optimization of the enzymatic one pot reaction for the synthesis of uridine 5′-diphosphogalactose

Lee, Jun Ho; Chung, Seung-Wook; Lee, Hwajin; Jang, Kyuong-Soon; Lee, Sun‐Gu; Kim, Byung‐Gee

doi:10.1007/s00449-009-0365-2

Cited by 25 publications

(13 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…YP_003047172). Plasmid pET24ma was employed as an expression vector. To express CadA genes fused with a 6X His‐tagged polypeptide at C‐terminus, the coding region of CadA was amplified by PCR using forward primer 5′‐ TATAATCATATGAACGTTATTGCAATATTG ‐3′ and reverse primer 5′‐ ATATA AAGCTTTTTTTTGCTTTCTTCTTT ‐3′.…”

Section: Methodsmentioning

confidence: 99%

Simultaneously Enhancing the Stability and Catalytic Activity of Multimeric Lysine Decarboxylase CadA by Engineering Interface Regions for Enzymatic Production of Cadaverine at High Concentration of Lysine

Hong

Lee

Park

et al. 2017

Biotechnology Journal

Self Cite

View full text Add to dashboard Cite

Cadaverine (1,5-diaminopentane) is a major source of many industrial polyamides such as nylon and chelating agents. Currently, cadaverine is produced by the microbial fermentation of glucose to lysine, which is then decarboxylated by lysine decarboxylase (CadA). However, utilizing CadA for cadaverine production causes enzyme instability. In order to stabilize the CadA homo-decamer structure for in vitro decarboxylation reaction, mutants are designed. Of the four disulfide bond mutants in the multimeric interfacial region, B1 (F14C/K44C) showed a 216-folds increase in the half-life of CadA at 60 °C. On top of B1, another round of mutant screening is performed around F14C and K44C to generate B1/L7M/N8G, which is then examined for cadaverine production (2M lysine and 10% v/v of cell-extract at 50 °C). The reaction pH increased from 4.9 to 8.3, and the final titer of the mutant is 157 g L , that is, 76.7% conversion yield in 9.5 h, whereas the wild-type gave 119 g L , that is, 58.2% conversion yield in 9.5 h.

show abstract

Section: Methodsmentioning

confidence: 99%

Simultaneously Enhancing the Stability and Catalytic Activity of Multimeric Lysine Decarboxylase CadA by Engineering Interface Regions for Enzymatic Production of Cadaverine at High Concentration of Lysine

Hong

Lee

Park

et al. 2017

Biotechnology Journal

Self Cite

View full text Add to dashboard Cite

show abstract

“…Different (re)generation schemes for the in-situ production of nucleotide sugars for the transfer of a galactosylpyranoside moiety with either stoichiometric amounts of NTP [199], PEP [200], poly(phosphate) [189], or acetyl phosphate [201] are shown in Figure 9. The main driving force for the glycosylation reaction is the exergonic hydrolysis of pyrophosphate to phosphate by pyrophosphatases or alkaline phosphatases.…”

Section: Application Of Glycosyl Transferases In Organic Synthesismentioning

confidence: 99%

Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach

Mestrom

Przypis

Kowalczykiewicz

et al. 2019

IJMS

View full text Add to dashboard Cite

Enzymes are nature's catalyst of choice for the highly selective and efficient coupling of carbohydrates. Enzymatic sugar coupling is a competitive technology for industrial glycosylation reactions, since chemical synthetic routes require extensive use of laborious protection group manipulations and often lack regio-and stereoselectivity. The application of Leloir glycosyltransferases has received considerable attention in recent years and offers excellent control over the reactivity and selectivity of glycosylation reactions with unprotected carbohydrates, paving the way for previously inaccessible synthetic routes. The development of nucleotide recycling cascades has allowed for the efficient production and reuse of nucleotide sugar donors in robust one-pot multi-enzyme glycosylation cascades. In this way, large glycans and glycoconjugates with complex stereochemistry can be constructed. With recent advances, LeLoir glycosyltransferases are close to being applied industrially in multi-enzyme, programmable cascade glycosylations.hydroxynitrile lyases catalyzed the enzymatic hydrolysis of the glycoside amygdalin [3]. Moving almost two centuries forward, the largest volumetric biocatalytic industrial process is the application of glucose isomerase for the production of high fructose syrup for food and drink applications, producing fructose from glucose at 10 7 tons per year [4]. The secret of the success of enzymes in the production or treatment of carbohydrates and glycosides is their exquisite stereo-and regioselectivity. The excellent selectivity of enzymes is required due to the diversity of structural features of carbohydrates [5], comprising d-and l-epimers, ring size, anomeric configuration, linkages, branching, and oxidation state(s). Since drug targets often exhibit specificity for all of these structural features, the production process should not contain any side-products to prevent undesired side-effects [6].The challenge in the synthesis of carbohydrates is their wide variety of functionalities and stereochemistry ( Figure 1). (Poly)hydroxyaldehydes containing a terminal aldehyde are referred to as aldoses and (poly)hydroxyketones are defined as ketoses. In aqueous solutions, monosaccharides form equilibrium mixtures of linear open-chain and ring-closed 5-or 6-membered furanoses or pyranoses, respectively. For aldoses, the asymmetric ring forms at C-1. For ketoses, it closes at C-2 as an axial (α) or equatorial (β) hemiacetal or hemiketal, respectively (commonly defined as the anomeric center). A glycosidic linkage is a covalent O-, S-, N-, or C-bond connecting a monosaccharide to another residue resulting in a glycoside, while glucoside is specific for a glucose moiety. The equatorial or axial position of the glycosidic bond is referred to as α-(axial) or β-linkage (equatorial). The number of carbohydrates linked via glycosidic bonds can be subdivided into oligosaccharides with two to ten linked carbohydrates, while polysaccharides (glycans) contain more than ten glycosidic bonds. A glycan either con...

show abstract

“…The BCAT gene of E. coli K‐12 (accession number U00096) was amplified from the E. coli template vector pET24ma‐BCAT (Lee et al, ) with the GeneAmp PCR System 2400 (Applied Biosystems, Foster City, CA). The PCR primer forward was 5′‐TGCCTGCAGAAAGGAGATATAGATGTGTCAGATGACCACGAAGAAAGCT‐3′ and the reverse primer was 5′‐ATAGGAATTCTTATTGATTAACTTGATCTAACCAGCCCCATTTATC‐3′.…”

Section: Methodsmentioning

confidence: 99%

Production of non‐proteinogenic amino acids from α‐keto acid precursors with recombinant Corynebacterium glutamicum

Kim

Lee

Wittmann

et al. 2013

Biotech & Bioengineering

View full text Add to dashboard Cite

In the present work, Corynebacterium glutamicum was metabolically engineered for the enantioselective synthesis of non-proteinogenic amino acids as valuable building blocks for pharmaceuticals and agrochemicals. The novel bio-catalytic activity of C. glutamicum was obtained by heterologous expression of the branched chain aminotransferase IlvE from Escherichia coli. Upon this modification, the recombinant cells converted the α-keto acid precursor 2-(3-hydroxy-1-adamantyl)-2-oxoethanoic acid (HOAE) into the corresponding amino acid 2-(3-hydroxy-1-adamantyl)-(2S)-amino ethanoic acid (HAAE). Similarly, also L-tert-leucine could be obtained from trimethyl pyruvate indicating a broader applicability of the novel strategy. In both cases, the amino group donor glutamate was supplied from the endogenous metabolism of the recombinant producer. Hereby, the uptake of the precursor and secretion of the product was supported by an enhanced cell permeability through treatment of ethambutol, which inhibits arabinosyl transferases involved in cell wall biosynthesis. The excretion of HAAE into the reaction medium was linked to the secretion of glutamate, indicating a similar mechanism for the export of both compounds. On the other hand, the efflux of L-tert-leucine appeared to be driven by active transport. Subsequent bioprocess engineering enabled HAAE and L-tert-leucine to be produced at a rate of 0.21 and 0.42 mmol (g dry cells)⁻¹ h⁻¹, respectively up to a final product titer of 40 mM. Beyond the given examples, integrated metabolic and cell envelop engineering might extend the production of a variety of other non-proteinogenic amino acids as well as chiral amines by C. glutamicum.

show abstract

Optimization of the enzymatic one pot reaction for the synthesis of uridine 5′-diphosphogalactose

Cited by 25 publications

References 17 publications

Simultaneously Enhancing the Stability and Catalytic Activity of Multimeric Lysine Decarboxylase CadA by Engineering Interface Regions for Enzymatic Production of Cadaverine at High Concentration of Lysine

Simultaneously Enhancing the Stability and Catalytic Activity of Multimeric Lysine Decarboxylase CadA by Engineering Interface Regions for Enzymatic Production of Cadaverine at High Concentration of Lysine

Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach

Production of non‐proteinogenic amino acids from α‐keto acid precursors with recombinant Corynebacterium glutamicum

Contact Info

Product

Resources

About