IntroductionT-cell acute lymphoblastic leukemia (T-ALL) is an aggressive malignancy characterized by the accumulation of undifferentiated thymocytes that have acquired multiple genomic aberrations affecting critical transcriptional and signaling pathways. 1,2 T-ALL is also frequently characterized by the expression of constitutively activated tyrosine kinases, such as ABL1, LCK, JAK1, and JAK3. [3][4][5][6][7] Recently identified mutations in the IL-7 receptor ⣠(IL-7R) and deletions of the tyrosine phosphatase PTPN2 were also reported to affect tyrosine kinase signaling. [8][9][10] The genetic and functional data presented in this work now identify the tyrosine phosphatase CD45 as a new tumor suppressor gene in T-ALL. CD45 is a transmembrane protein that is abundantly present on the surface of all nucleated hematopoietic cells. CD45 is encoded by the PTPRC gene and is known to regulate phosphorylation of SRC and JAK family kinases. 11-13
Methods
Cell cultureHEK293T and human T-ALL cell lines were cultured in RPMI 1640 medium supplemented with FBS. MOHITO cells were cultured and transduced as described previously. 14 For dose-response curves, T-ALL cell lines were seeded out in triplicate in 24-well plates at a density of 5 Ï« 10 5 cells/mL and incubated for 48 hours with the JAK family kinase inhibitor INCB018424 (Chemietek). Viable cell numbers were determined using CellTiter 96 AQ ueous One Solution (Promega) and a Victor X4 plate reader (PerkinElmer Life and Analytical Sciences).
Patient samples and sequence analysisPatient genomic DNA was collected at various institutions at time of diagnosis and remission. All samples were obtained according to the guidelines of the local ethics committees at KU Leuven, and informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. All coding exons of PTPRC as well as exon 6 of IL-7R were amplified and PCR products were directly sequenced.
ConstructsThe open reading frames of wild-type and mutant CD45R0 were cloned into pMSCV-Puro (Clontech). Retroviral vectors expressing nonsilencing or CD45 targeting shRNAs were obtained by cloning short hairpin RNA sequences into a pMSCV-GFP construct containing a mir30 flanking cassette. shRNA sequences: CTCGCTTGGGCGAGAGTAA (shControl) and AGCAGATGATATTCCAAAGAAA (shCD45).
Western blottingThe following antibodies were used: anti-CD45 (clone 69; BD Biosciences); anti-phospho-JAK1 (Tyr1022/1023), anti-STAT5 (clone L-20; Santa Cruz Biotechnology); anti-JAK1 (clone73; Millipore); anti-phospho-STAT5 (Tyr694), anti-phospho-STAT3 (Tyr705), anti-STAT3 (79D7; Cell Signaling); anti-beta actin (Sigma-Aldrich). For personal use only. on March 24, 2019. by guest www.bloodjournal.org From
Immunocomplex phosphatase activity assayDiFMUP immunocomplex phosphatase activity assay 15 was performed as described earlier. 16 Conversion of DiFMUP into DiFMU was monitored using a Victor X4 plate reader. Initial conversion rates were calculated from the slope of the linear curve of fluorescence versus time for each substrate c...