Obesity and childhood asthma in male schoolchildren in Saudi Arabia: Is there a role for leptin, interleukin-4, interleukin-5, and interleukin-21?

Al-Ayed, Mohammed Saeed Zayed; Alshaybari, Khalid; Alshehri, Dhafer Batti; Jamaan, Alzahrani; Nasser, Iman; Alaamri, Hamdan; Alaseeri, Wed Ahmad; Mahfouz, Ahmed A.; Alsareli, Saeed Ali; Asaad, Ahmed Morad; Magzoub, Aamir; Qureshi, Mohamed Ansar; Shalayel, Mohammed Helmy Faris

doi:10.5144/0256-4947.2019.295

Cited by 15 publications

(11 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“… 67 In addition, some comorbidities linked to obesity may contribute to a higher risk of pulmonary infections, such as the presence of asthma, which is highly prevalent among obese children, 68 and obstructive sleep apnea. 69 Regarding asthma, the same inflammatory mechanisms linked to leptin and IL-2, which explain the high prevalence and severity of this disease in obese children, 70 are also involved in the severity of COVID-19. Finally, in addition to aspects related to impaired lung function, obese children have low exercise tolerance, which closes a vicious circle.…”

Section: Pathophysiology Of Obesity and Its Relationship With Covid-1mentioning

confidence: 99%

COVID-19 and obesity in childhood and adolescence: a clinical review

Nogueira‐de‐Almeida

Ciampo

Ferraz

et al. 2020

Jornal de Pediatria

154

128

View full text Add to dashboard Cite

Objective To identify factors that contribute to the increased susceptibility and severity of COVID-19 in obese children and adolescents, and its health consequences. Sources Studies published between 2000 and 2020 in the PubMed, MEDLINE, Scopus, SciELO, and Cochrane databases. Summary of findings Obesity is a highly prevalent comorbidity in severe cases of COVID-19 in children and adolescents; social isolation may lead to increase fat accumulation. Excessive adipose tissue, deficit in lean mass, insulin resistance, dyslipidemia, hypertension, high levels of proinflammatory cytokines, and low intake of essential nutrients are factors that compromise the functioning of organs and systems in obese individuals. These factors are associated with damage to immune, cardiovascular, respiratory, and urinary systems, along with modification of the intestinal microbiota (dysbiosis). In severe acute respiratory syndrome coronavirus 2 infection, these organic changes from obesity may increase the need for ventilatory assistance, risk of thromboembolism, reduced glomerular filtration rate, changes in the innate and adaptive immune response, and perpetuation of the chronic inflammatory response. Conclusions The need for social isolation can have the effect of causing or worsening obesity and its comorbidities, and pediatricians need to be aware of this issue. Facing children with suspected or confirmed COVID-19, health professionals should 1) diagnose excess weight; 2) advise on health care in times of isolation; 3) screen for comorbidities, ensuring that treatment is not interrupted; 4) measure levels of immunonutrients; 5) guide the family in understanding the specifics of the situation; and 6) refer to units qualified to care for obese children and adolescents when necessary.

show abstract

Section: Pathophysiology Of Obesity and Its Relationship With Covid-1mentioning

confidence: 99%

COVID-19 and obesity in childhood and adolescence: a clinical review

Nogueira‐de‐Almeida

Ciampo

Ferraz

et al. 2020

Jornal de Pediatria

154

128

View full text Add to dashboard Cite

show abstract

“…Fatty tissue has been in the focus of science for quite some time because of the many negative health effects of overweight. With regard to asthma, the pro-inflammatory effects of adipose tissue and the potential role of this inflammation as an effect modifier on bronchial asthma have been investigated in several studies ( Figure 1 , and Figure 2 ) [ 25 , 26 , 27 , 28 ]. In normal-weight people, adipose tissue typically secretes small amounts of pro-inflammatory cytokines such as IL-6, IL-8, tumor necrosis factor-α (TNF-α) and adipokines such as leptin, and produces large amounts of the anti-inflammatory adipokine adiponectin.…”

Section: Inflammation Pattern In Obesity-associated Asthmamentioning

confidence: 99%

“…Levels of leptin are higher in obese children and adults than in non-obese ones [ 30 , 37 ]. However, the expression of leptin is significantly increased in obese children and adults with asthma compared to obese patients without asthma [ 9 , 26 ]. Children with uncontrolled asthma had higher leptin levels than those with controlled asthma ( Figure 2 ) [ 26 ].…”

Section: Inflammation Pattern In Obesity-associated Asthmamentioning

confidence: 99%

“…Thus, there are connections between type 1 (TH2-low) and type 2 (TH2-high) inflammation [ 48 , 49 , 50 ]. This and the activation of congenital type 2 lymphoid cells (ILC2s) could explain why elevated T2 cytokines such as IL-4 and IL-5 are found in asthma in parallel to an increase in TNF-α [ 26 , 44 ].…”

Section: Inflammation Pattern In Obesity-associated Asthmamentioning

confidence: 99%

See 1 more Smart Citation

Obesity-associated asthma in childhood

Mangova¹,

Lipek²,

Hove³

et al. 2020

ALS

View full text Add to dashboard Cite

Obesity and bronchial asthma are very common diseases in children and adolescents, associated with a considerable burden of disease, reduced quality of life and comorbidities. Obesity is a significant risk factor for bronchial asthma. On the one hand, obesity leads to changes in the mechanics and function of the lungs and chest. On the other hand, obesity-associated inflammatory processes with increased production of leptin and cytokines may trigger bronchial inflammation with the appearance of asthmatic symptoms. The diseases are also linked by genetic factors. Physical activity and weight reduction have a significant benefit. Pharmacotherapy must be based on the pattern of inflammation. This article summarizes the current state of the literature on the association of asthma and obesity and presents current and possible future treatment options.

show abstract

“…First identified in 1980, interleukin-4 (IL-4) is a multifunctional cytokine mainly produced by T cells, mast cells, eosinophils, and basophils (LaPorte et al 2008). IL-4 is a potent prototypic member of the Th2type cytokine subset that acts as a mediator for proinflammatory chemokines (Kuran et al 2019;Al-Ayed et al 2019). IL-4 suppresses adipocyte differentiation and thus enhances lipolysis (Tsao et al 2014).…”

Section: Introductionmentioning

confidence: 99%

Association of interleukin-4 polymorphism with diabetic retinopathy and neuropathy in a Sudanese population

et al. 2021

View full text Add to dashboard Cite

Background Interleukin-4 (IL-4) is a multifunctional cytokine; involved in the regulation of immune responses, as well as in the pathogenicity of many diseases, such as diabetes mellitus. Some researchers suggested that IL-4 protects the human pancreatic islet from cytotoxic damages, whereas others suggested some inhibitory actions of IL-4 on pancreatic islets. This study aimed to assess the role of IL-4 genotypes of intron 3 variable number of tandem repeats of the IL-4 gene in diabetic retinopathy and diabetic neuropathy in Sudanese patients with type 2 diabetes mellitus (T2DM). This case–control study was performed in a number of Khartoum state hospitals in Sudan. The study enrolled 181 Sudanese patients, 115 (57 females and 58 males) diagnosed with T2DM and 66 (29 females and 37 males) healthy persons who served as control subjects. Polymerase chain reaction was used for the analysis of IL-4, which was amplified using the following amplification sequence (forward primer: CACGACGTTGTAAAACGACTAGGCTGAAAGGGGGAAAGC; reverse primer: CTGTTCACCTCAACTGCTCC). Biochemical analyses for highly sensitive C- reactive protein (hs-CRP), glycated hemoglobin (HbA1c), fasting plasma glucose, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein were performed using a chemical analyzer. Results The study showed that in the diabetic group, 49(42.6%) had diabetic retinopathy, whereas 7(6.1%) had diabetic neuropathy. The B1B1 genotype was found to be a higher risk factor for developing diabetic retinopathy than B2B2 [P = 0.028; Odds ratio (OR) = 1.381; 95% confidence interval (CI) 1.344–9.062], whereas the B1B2 genotype was found to be insignificantly associated with retinopathy (P = 0.357; OR = 1.570; 95% CI 0.654–3.887). Furthermore, hs-CRP and HbA1c were significantly increased in diabetic neuropathy with IL-4 B1B1 genotype. Conclusions IL-4 gene polymorphisms can be good markers for the early identification of risk for diabetic retinopathy and neuropathy in Sudanese people. The hs-CRP and HbA1c in diabetic patients with IL-4 B1B1 genotype may be predisposition predictors of diabetic neuropathy.

show abstract

Obesity and childhood asthma in male schoolchildren in Saudi Arabia: Is there a role for leptin, interleukin-4, interleukin-5, and interleukin-21?

Cited by 15 publications

References 49 publications

COVID-19 and obesity in childhood and adolescence: a clinical review

COVID-19 and obesity in childhood and adolescence: a clinical review

Obesity-associated asthma in childhood

Association of interleukin-4 polymorphism with diabetic retinopathy and neuropathy in a Sudanese population

Contact Info

Product

Resources

About