Notch activation enhances mesenchymal stem cell sheet osteogenic potential by inhibition of cellular senescence

Abstract

Our previous studies have confirmed the therapeutic effects of mesenchymal stem cell (MSC) monolayer sheet transplantation on allograft repair. A limiting factor in their application is the loss of MSC multi-potency as a result of high density sheet culture-induced senescence. In the study reported in this article, we tested whether Notch activation could be used to prevent or delay sheet culture-induced cell aging. Our results showed that, during in vitro long-term (5-day) cell sheet culture, MSCs progressively lose their progenitor characteristics. In contrast, Notch activation by Jagged1 in MSC sheet culture showed reduced cellular senescence and cell cycle arrest compared with control MSCs without Notch activation. Importantly, knockdown of Notch target gene Hes1 totally blocked the inhibition effect of Jagged1 on cellular senescence. Finally, the in vivo allograft transplantation data showed a significant enhanced callus formation and biomechanical properties in Notch activation cultured long-term sheet groups when compared with long-term cultured sheet without Notch activation. Our results suggest that Notch activation by Jagged1 could be used to overcome the stem cell aging caused by high density sheet culture, thereby increasing the therapeutic potential of MSC sheets for tissue regeneration.

The roles of signaling pathways in bone repair and regeneration

“…In other words, Notch activation by Jag‐1 in MSC sheet culture showed decreased cellular senescence and cell cycle arrest. In addition, the in vivo allograft transplantation data revealed a significant increased callus formation (Tian et al, ). In addition, Chakravorty et al () showed that the activation of the Notch signaling pathway in titanium implant surfaces, which have improved osteogenic properties, leads to enhanced osteogenic differentiation as evidenced by a higher expression of osteogenic markers bone sialoprotein and osteocalcin, and bone differentiation factors BMP2, BMP6, and GDF15.…”

Notch activation promotes osteoblast mineralization by inhibition of apoptosis

“…Besides proliferation, JAG1 also plays a critical role in the regulation of functional cell death and survival (Regan & Long, ). One recent study from our group clearly showed that JAG1‐induced Notch activation inhibits cellular senescence in mesenchymal progenitor cell cultures (Tian et al, ). In this study, we further analyzed the apoptotic cell death during JAG1‐mediated osteoblast differentiation.…”

“…The sequences for each primer pair were as follows: CyclinD1: forward primer, 5′‐ATGGAACATCAGCTGCTGT‐3′ and reverse primer, 5′‐TCAGATGTCCACATCCCGC‐3′; Runx2, forward primer 5′‐CACTGCCACCTCTGACTTCT‐3′ and reverse primer 5′‐CACCATCATTCTGGTTAGGC‐3′; Alkaline phosphatase (ALP): forward primer 5′‐GGGCATTGTGACTACCACTC‐3′, and reverse primer 5′‐AGTCAGGTTGTTCCGATTCA‐3′; Osteocalcin (OC), forward primer 5′‐TGGCCATGCTGACTGCAGCC‐3′, reverse primer 5′‐TGGGTAGGCGTCCCCCATGG‐3′; Bone sialoprotein (BSP), forward primer 5′‐AAGGAACCAAAGCATCAAGAATTAG‐3′ and reverse primer 5′‐AGATGTCATCAGGCAGCTTGAC‐3′; Type I collagen (COl1a1), forward primer 5′‐GTTTGGCCTGAAGCAGAGAC‐3′ and reverse primer 5′‐TCTAAATGGGCCACTTCCAC‐3′; Hey1: forward primer 5′‐GCTCACCCAGACTACAGCTC‐3′ and reverse primer 5′‐ CTCGATGATGCCTCTCCGTC‐3′; Hes1: forward primer 5′‐ TTCCTCCTCCCCGGTGGCTG‐3′ and reverse primer 5′‐TGCCCTTCGCCTCTTCTCCA‐3′; β‐actin: forward primer 5′‐ACCACAGTCCATGCCATCAC‐3′, and reverse primer 5′‐TCCACCACCC TGTTGCTGTA‐3′. The relative expression level of target genes was normalized with geNorm software (Primer Design Ltd) using β‐actin gene as a reference to determine the normalization factor (Tian et al, ).…”

Oleanolic acid induces osteosarcoma cell apoptosis by inhibition of Notch signaling

“…In vitro cell growth was monitored by cell number count and cumulative population doubling time (DT) calculation. DT was examined using the formula: (t − t0) · log2/log (N − N0), where t − t0 is culture time in hours, N is the number of harvested cells, and N0 is the number of cells in the initial seeding …”