Non-coding RNAs derived from the foot-and-mouth disease virus genome trigger broad antiviral activity against coronaviruses

Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the causative agent of a potentially severe respiratory disease, the coronavirus disease 2019 (COVID-19), an ongoing pandemic with limited therapeutic options. Here, we assessed the anti-coronavirus activity of synthetic RNAs mimicking specific domains in the non-coding regions of the foot-and-mouth disease virus (FMDV) genome (ncRNAs). These molecules are known to exert broad-spectrum antiviral activity in cell culture, mice and pigs effectively triggering the host innate immune response. The ncRNAs showed potent antiviral activity against SARS-CoV-2 after transfection in human intestinal Caco-2 and lung epithelium Calu-3 2B4 cells. When the in vivo efficacy of the FMDV ncRNAs was assessed in K18-hACE2 mice, administration of naked ncRNA before intranasal SARS-CoV-2 infection significantly decreased the viral load and the levels of pro-inflammatory cytokines in the lungs compared with untreated infected mice. The ncRNAs were also highly efficacious when assayed against common human HCoV-229E and porcine transmissible gastroenteritis virus (TGEV) in hepatocyte-derived Huh-7 and swine testis ST cells, respectively. These results are a proof of concept of the pan-coronavirus antiviral activity of the FMDV ncRNAs including human and animal divergent coronaviruses and potentially enhance our ability to fight future emerging variants.

Susceptibility and transmissibility of SARS-CoV-2 variants in transgenic mice expressing the cat angiotensin-converting enzyme 2 (ACE-2) receptor

“…This addition was previously proven necessary for robust epithelial cell-specific expression. [ 18 ]. C57BL/6 mice were used for transgene production, with controlled housing conditions.…”

“…PCR analysis using specific primers (ATCCCTGGCTTTCTATTCATGG/ GCCTGCAATTGACGTTTGACGGT) confirmed the presence of the transgene in the offspring, with founders verified by Sanger sequencing. Four transgenic lines were generated, and mRNA expression of cACE2 in the trachea, lung, and colon was determined by qRT-PCR following already described procedures [ 18 ] and primers (GGCTCCTTCTCAGCTTTGCTGC/ GCCTGCAATTGACGTTTGACGGT), for selection of the lines with the best expression. Heterozygotes were utilized in all experiments, with wild-type B6 (WT) mice as negative controls.…”

“…Groups ( n = 12) of wild-type (WT) C57BL/6, transgenic hACE2 [ 18 ], and newly generated cACE2 mice were anesthetized with 5–2% of isoflurane (+0.5–1 l/min) and intranasally (i.n.) inoculated with 50 μl of SARS-CoV-2 D614G(S) (5 × 10 4 plaque forming units (PFU)/mouse) or the omicron variant (10 4 TCID 50 /mouse).…”

“…Total RNA was extracted from the right lung of the mice to determine the presence and levels of genomic SARS-CoV-2 RNA and to perform relative quantification of the pro-inflammatory IL-6 and TNF-α cytokines by q-RT-PCR [ 18 ].…”