No mutations found in exons of TP53, H-RAS and K-RAS genes in liver of male Wistar rats submitted to a medium-term chemical carcinogenesis assay

Abstract

The standard protocol to evaluate the carcinogenic potential of chemicals is the long-term bioassay in rodents, not performed in developing countries due to its high cost and complex operational procedures. Our laboratory has established an alternative medium-term bioassay in Wistar rats, also called DMBDD assay, based on the paradigm initiation/promotion of chemical carcinogenesis. This method was accepted by the Brazilian Environment Agency (IBAMA) as an official source of evidence of carcinogenicity. The aim of this study was to evaluate alterations in exons 5 to 8 of the tumor suppressor gene TP53 and exons 1 and 2 of oncogenes K-RAS and H-RAS in neoplastic and preneoplastic hepatic lesions observed in DMBDD assay. The characterization of these alterations may contribute to the recognition of patterns of damage in critical genes, as well as to suggest mechanisms of action of the compounds tested in the protocol. Sixty male Wistar rats were separated into 3 groups: the first was treated with no chemicals; the second received five initiating agents and the third received initiation followed by phenobarbital. Liver DNA samples (obtained from formalin-fixed and paraffin-embedded tissues after histological analysis) were evaluated by the non-isotopic PCR-SSCP technique. No changes in any analyzed exons were detected by the PCR-SSCP banding pattern in all experimental groups. This result suggests that liver mutations in exons 5 to 8 of TP53 and exons 1 and 2 of H-RAS and K-RAS are not among the early molecular alterations occurring in the hepatic carcinogenesis process induced by the DMBDD protocol in male Wistar rats. No mutations found in exons of TP53, H-RAS and K-RAS genes in liver of male Wistar rats submitted to a medium-term chemical carcinogenesis assay Castelli et al.

Evaluation of Dietary Supplement Intake (Yeast Tablets) on Pregnant Albino Rats and Their Fetuses (Implications of Yeast Tablets on Rats & Fetuses)

“…After centrifugation, DNA was washed twice and finally eluted using the elution buffer. The p53 exons 7 and 8 were amplified using the primer sequences sense TGTGCTGTGCCTCCTCTTGTC and antisense GCGCCTCCACCTTCTTTGTCC for exon 7 (198 bp) and sense CCCTTGCTCTCTCCTTCCATA and antisense TTGGTACCTTAAGGGTGAAATA for exon 8 (102 bp) [18]. In the amplification reaction the initial denaturation at 98•C for 5 min was followed by 35 cycles of denaturation at 95•C for 1min, annealing at 55•C for 1min and extension at 72•C for 1min were performed.…”

Protective Effects of Zinc as Antioxidant Against the Genotoxic Potential of Deltamethrin

“…The mixture was heated at 98°C for 10 minutes, and immediately chilled on ice for 10 min. The total volume was applied to a 15% polyacrylamide gel in 1x TBE buffer (Tris 100 mM, Boric Acid 9mM, EDTA 1mM) and electophoresed at 100V [27]. Gels were stained with ethidium bromide for 2 min and then destained by washing in deionized water.…”