NAD(P)H quinone oxidoreductase 1 codon 609 polymorphism and its association to colorectal cancer

Harth, Volker; Donat, Susanne; Ko, Yon; Abel, Josef; Vetter, Hans; Brüning, Thomas

doi:10.1007/s002040050004

Cited by 45 publications

(22 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The ORs for the NQO1 *2/*2 genotype in these studies, which totaled 1,343 patients with colorectal cancer and 1,440 control subjects, ranged from 1.5 to 2.9. However, the current results differ from three other studies with colon cancer patients, which found no significant difference in the NQO1 genotype distribution in the patient population compared with controls (42,54,55). These latter studies totaled 887 patients with colorectal cancer and 1,438 controls.…”

Section: Discussioncontrasting

confidence: 99%

See 1 more Smart Citation

A NAD(P)H:Quinone Oxidoreductase 1 Polymorphism Is a Risk Factor for Human Colon Cancer

Begleiter¹,

Hewitt²,

Maksymiuk³

et al. 2006

Cancer Epidemiology, Biomarkers &Amp; Prevention

View full text Add to dashboard Cite

Colon cancer is one of the most common cancers in North America and generally develops from colonic epithelial cells following initiation by carcinogens. We have shown that the phase II detoxifying enzyme, NAD(P)H:quinone oxidoreductase 1 (NQO1) contributes to the inhibition of carcinogen-induced colon cancer in rats at both the initiation and postinitiation stages. An inactivating polymorphism at base 609 of the NQO1 gene, 609 C (NQO1 *1) ! 609 T (NQO1 *2), occurs at high frequency in the human population. Thus, we carried out a case-control study to determine if this polymorphism is associated with an increased risk of developing colon cancer. A total of 298 patients with colon cancer and 349 healthy controls matched for age, gender, and ethnic origin were enrolled in the study. There was an increased incidence of the NQO1 *2/*2 genotype in patients with colon cancer, with a gender and age-adjusted odds ratio of 2.68 (95% confidence intervals, 1.14-6.28). However, the incidence of the NQO1 *1/*2 genotype was not increased in patients with colon cancer compared with controls. When the patient and control groups were stratified by tobacco and alcohol use, the incidences of the NQO1 *2/*2 genotype were increased in patients with colon cancer for tobacco and alcohol users and nonusers, suggesting that there is no interaction between the NQO1 base 609 polymorphism and tobacco or alcohol use. These results strongly suggest that NQO1 plays a significant role in preventing the development of colon cancer, and individuals with an NQO1 *2/*2 genotype are at an increased risk of developing this disease. (Cancer Epidemiol Biomarkers Prev 2006;15(12):2422 -6)

show abstract

Section: Discussioncontrasting

confidence: 99%

“…However, three other studies showed no significant differences in NQO1 genotype frequencies between patients with colorectal cancer and healthy controls (42,54,55). A recent meta-analysis suggested a statistically significant association of the NQO1 *2 allele with a moderately elevated risk of developing colorectal cancer (56).…”

Section: Introductionmentioning

confidence: 97%

A NAD(P)H:Quinone Oxidoreductase 1 Polymorphism Is a Risk Factor for Human Colon Cancer

Begleiter¹,

Hewitt²,

Maksymiuk³

et al. 2006

Cancer Epidemiology, Biomarkers &Amp; Prevention

View full text Add to dashboard Cite

show abstract

“…13 CYP2E1*5B as described by Choi et al, 14 and NQO1*2 as described by Harth et al 15 For the detection of MTHFR C677T we followed the method recommended by Roche (Applied Science), using the primers MTHFR_s (cgaagcagggagctttgaggctg) and MTHFR_as (aggacggtgcggtgagagtg) and the hybridization probes MTHFR_LC labeled with Red640 at the 5é nd (LC Red640-cgggagccgatttcatcat-ph) and MTHFR_3FL (tgacctgaagcacttgaaggagaaggtgtc X) labeled with fluorescein. The del{GSTT1} and del{GSTM1} polymorphisms were detected following the conventional PCR method of Naoe et al, 16 comprising a multiplex PCR that co-amplifies the target genes simultaneously with the β-globin gene used as a reference control gene.…”

Section: Genotyping Of Polymorphismsmentioning

confidence: 99%

The potential effect of gender in combination with common genetic polymorphisms of drug-metabolizing enzymes on the risk of developing acute leukemia

Bolufer¹,

Collado²,

Barragán³

et al. 2007

Haematologica

View full text Add to dashboard Cite

Background and ObjectivesWe examined common polymorphisms in the genes for glutathione S-transferase (GST), cytochrome P450 (CYP), quinone oxoreductase (NQO1), methylene tetrahydrofolate reductase (MTHFR), and thymidylate synthetase (TYMS) and the role of gender associated with the susceptibility to de novo acute leukemia (AL). Design and MethodsWe conducted a case-control study analyzing the prevalence of the polymorphisms CYP1A1*2A, CYP2E1*5B, CYP3A4*1B, del{GSTT1}, del{GSTM1}, NQO1*2, MTHFR C6777, and TYMS 2R/3R in 443 patients with AL [302 with acute myeloblastic leukemia (AML) and 141 with acute lymphoblastic leukemia (ALL)] and 454 control volunteers, using polymerase chain reaction (PCR)-based methods. ResultsWe found a higher incidence of del{GSTT1} in patients with AML than among controls (25.6% vs. 13.7%, OR=2.2, p<0.001) and a higher incidence of NQO1*2 homozygosity (NQO1*2hom.) in males with the M3 FAB subtype than in control males (8.6% vs. 2.2%, OR=4.9, p=0.02). The del{GSTT1} and NQO1*2hom. polymorphisms increased the risk of ALL (OR=2.2 and 3.0, p=0.001 and 0.003, respectively). The higher risk conferred by NQO1*2hom. and del{GSTT1} mainly affected males (OR=6.1 and 2.4; p=0.002 and 0.005, respectively). Interpretation and ConclusionsMales harboring NQO1*2hom. and del{GSTT1} polymorphisms showed a higher risk than females of developing AL. Thus, gender might influence the risk of AL associated with these genetic polymorphisms. On the whole AL is more common in males of all age groups, 4 a fact that remains unexplained. Although the clinical and biological aspects of leukemia are well documented, little is known about the factors that condition an individual's susceptibility to de novo leukemia. Normal polymorphic variations in several genes, together with dietary effects, environmental exposure to carcinogens, and individual immune system characteristics are likely to be factors that predispose individuals to develop AL.5 Polymorphisms could also explain the different incidence of AL observed between the genders.Genetic polymorphisms in the drug-metabolizing enzymes are extremely common and may contribute to the risk of developing cancers. These polymorphisms could explain differences in the way in which individuals metabolize chemical agents.6 Studies have included polymorphisms of genes coding for P450 cytochromes (CYP), which are involved in phase I of metabolism (oxidation/activation). Most polymorphisms described for these genes, such as T6235C of CYP1A1 (CYP1A1*2A), C-1019T of CYP2E1 (CYP2E1*5B), and -A290G of CYP3A4 (CYP3A4*1B), are believed to cause an increase in enzymatic activity. They have been implicated in the bioactivation of several chemical carcinogens and the conversion of polyaromatic hydrocarbons from tobacco smoke into intermediate reactive metabolites, some of which can damage DNA.7 Glutathione Smethyl transferases (GST) are implicated in phase II of metabolism (conjugation/detoxification). Two widespread genetic polymorphisms that involve deletions in the GSTT1 and GSTM1 ge...

show abstract

“…6 NQO1 gene located on chromosome 16 (16q22.1) encodes an obligate two-electron reductase that can either bioactivate or detoxify quinones and has been proposed to play an important role in chemoprevention. 7 The polymorphism in exon 6 of NQO1 (C609T, Pro187Ser, NQO1*1/ *2) was associated with the risk of colorectal cancer 8 and myeloid leukemia. 9 The case -control study of Hamajima et al 10 on Japanese suggested that the variant NQO1*2/*2 genotype increased the risk of cancers of the esophagus and lung but not breast.…”

Section: Introductionmentioning

confidence: 99%

Breast cancer: role of polymorphisms in biotransformation enzymes

et al. 2004

View full text Add to dashboard Cite

We aimed at determining whether any association exists between genetic polymorphisms in epoxide hydrolase (EPHX1), NADPH-quinone oxidoreductase (NQO1), glutathione S-transferases (GSTM1/P1/T1) and individual susceptibility to breast cancer. Polymerase chain reaction-restriction fragment length polymorphism-based genotyping assays were used to determine the frequency of polymorphisms in EPHX1 (exons 3 and 4), NQO1 (exon 6), GSTM1 (deletion), GSTP1 (exon 5), and GSTT1 (deletion) in a case -control study comprised of 238 patients with breast cancer and 313 healthy individuals. The distribution of genotypes in exon 6 of NQO1 was significantly different between the control group and breast cancer cases. Age-adjusted odds ratio (OR) for variant genotype NQO1*2/*2 was 3.68 (confidence interval (CI) ¼ 1.41 -9.62, P ¼ 0.008). Association of GSTP1*2/*2 genotype as well as that of low EPHX1 activity deduced by combinations of genotypes in exons 3 and 4 with breast cancer was suggestive, but nonsignificant. Individuals simultaneously lacking GSTM1 and carrying at least one GSTP1 variant allele were at significantly higher risk of breast cancer (OR ¼ 2.03, CI ¼ 1.18 -3.50, P ¼ 0.010). Combinations of either GSTM1null or GSTP1*2 with low activity of EPHX1 presented significant risk of breast cancer (OR ¼ 1.88, CI ¼ 1.00 -3.52, P ¼ 0.049 and OR ¼ 2.40, CI ¼ 1.15 -5.00, P ¼ 0.019, respectively) as well. In conclusion, the results suggest that genetic polymorphisms in biotransformation enzymes may play a significant role in the development of breast cancer.

show abstract

NAD(P)H quinone oxidoreductase 1 codon 609 polymorphism and its association to colorectal cancer

Cited by 45 publications

References 5 publications

A NAD(P)H:Quinone Oxidoreductase 1 Polymorphism Is a Risk Factor for Human Colon Cancer

A NAD(P)H:Quinone Oxidoreductase 1 Polymorphism Is a Risk Factor for Human Colon Cancer

The potential effect of gender in combination with common genetic polymorphisms of drug-metabolizing enzymes on the risk of developing acute leukemia

Breast cancer: role of polymorphisms in biotransformation enzymes

Contact Info

Product

Resources

About