MzPIP2;1: An Aquaporin Involved in Radial Water Movement in Both Water Uptake and Transportation, Altered the Drought and Salt Tolerance of Transgenic Arabidopsis

Abstract

BackgroundPlants are unavoidably subjected to various abiotic stressors, including high salinity, drought and low temperature, which results in water deficit and even death. Water uptake and transportation play a critical role in response to these stresses. Many aquaporin proteins, localized at different tissues, function in various transmembrane water movements. We targeted at the key aquaporin in charge of both water uptake in roots and radial water transportation from vascular tissues through the whole plant.ResultsThe MzPIP2;1 gene encoding a plasma membrane intrinsic protein was cloned from salt-tolerant apple rootstock Malus zumi Mats. The GUS gene was driven by MzPIP2;1 promoter in transgenic Arabidopsis. It indicated that MzPIP2;1 might function in the epidermal and vascular cells of roots, parenchyma cells around vessels through the stems and vascular tissues of leaves. The ectopically expressed MzPIP2;1 conferred the transgenic Arabidopsis plants enhanced tolerance to slight salt and drought stresses, but sensitive to moderate salt stress, which was indicated by root length, lateral root number, fresh weight and K+/Na+ ratio. In addition, the possible key cis-elements in response to salt, drought and cold stresses were isolated by the promoter deletion experiment.ConclusionThe MzPIP2;1 protein, as a PIP2 aquaporins subgroup member, involved in radial water movement, controls water absorption and usage efficiency and alters transgenic plants drought and salt tolerance.

Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

“…The ABRE and MBS cis- elements have been previously reported to be involved in ABA-mediated osmotic stress signaling in the regulation of drought-inducible gene expressions (Abreu and Aragão, 2007; Hou et al, 2016), whereas cis- element LTR is a low-temperature-responsive element and involved in the expression of cold-regulated genes (Brown et al, 2001). The link between the presence of stress-related cis- acting elements and the differential expression of aquaporin genes under various stress conditions have been reported in several plants (Alexandersson et al, 2010; Wang L. et al, 2015). …”

The Difference of Physiological and Proteomic Changes in Maize Leaves Adaptation to Drought, Heat, and Combined Both Stresses

“…In this study, drought stress and combined stress up-regulated the expression of aquaporin PIP2-6. Other results have shown that the over-expression of MzPIP2:1 in Arabidopsis enhances plant tolerance to drought (Wang et al, 2015). However, the over-expression of AtPIP1:2 in tobacco has been found to reduce plant tolerance to drought (Aharon et al, 2003).…”

Plant mitochondria synthesize melatonin and enhance the tolerance of plants to drought stress

“…The Arabidopsis ( Arabidopsis thaliana ecotype Colombia 0 and transgenic Arabidopsis lines ectopically expressing MzSNAT5 ) seeds were sterilized according the Wang et al . After vernalized 3 days at 4°C in dark, the seeds were sown and grown vertically on MS medium for 10 days and then they were transplanted into soil.…”

“…To predict the possible localization of MzSNAT5, its amino acid sequences were analyzed online (http://www.cbs.dtu.dk/services/TargetP/). The total RNA was extracted from the leaves of M. zumi Mats for cDNA synthesis as described by Wang et al . The coding sequence without stop codon of MzSNAT5 , amplified by PCR using specific primers carrying the restriction sites Pac I and Asc I (forward primer: TTAATTAAATGGCGGCAGCTACAG, reverse primer: GGCGCGCCTGCTGGCATCAAAGTCTAG), was inserted into the PMD19‐T simple vector (TaKaRa, Shiga, Japan).…”