Mxr1p, a Key Regulator of the Methanol Utilization Pathway and Peroxisomal Genes in Pichia pastoris

Abstract

Growth of the yeast Pichia pastoris on methanol induces the expression of genes whose products are required for its metabolism. Three of the methanol pathway enzymes are located in an organelle called the peroxisome. As a result, both methanol pathway enzymes and proteins involved in peroxisome biogenesis (PEX proteins) are induced in response to this substrate. The most highly regulated of these genes is AOX1, which encodes alcohol oxidase, the first enzyme of the methanol pathway, and a peroxisomal enzyme. To elucidate the molecular mechanisms responsible for methanol regulation, we identify genes required for the expression of AOX1. Mutations in one gene, named MXR1 (methanol expression regulator 1), result in strains that are unable to (i) grow on the peroxisomal substrates methanol and oleic acid, (ii) induce the transcription of AOX1 and other methanol pathway and PEX genes, and (iii) form normal-appearing peroxisomes in response to methanol. MXR1 encodes a large protein with a zinc finger DNA-binding domain near its N terminus that has similarity to Saccharomyces cerevisiae Adr1p. In addition, Mxr1p is localized to the nucleus in cells grown on methanol or other gluconeogenic substrates. Finally, Mxr1p specifically binds to sequences upstream of AOX1. We conclude that Mxr1p is a transcription factor that is necessary for the activation of many genes in response to methanol. We propose that MXR1 is the P. pastoris homologue of S. cerevisiae ADR1 but that it has gained new functions and lost others through evolution as a result of changes in the spectrum of genes that it controls.The ability to utilize methanol as a carbon and energy source is limited in eukaryotes to a few yeast species (1,34,57). The metabolic pathway is nearly identical in each species and begins with the oxidation of methanol to formaldehyde, which is catalyzed by the peroxisomal matrix enzyme alcohol oxidase (Aox). A by-product of this reaction is hydrogen peroxide, which is subsequently degraded to water and oxygen by a second peroxisomal enzyme catalase (Cat). The formaldehyde generated by Aox follows one of two paths. A portion leaves the peroxisome and is further oxidized by two cytoplasmic enzymes, formaldehyde dehydrogenase (Fld) and formate dehydrogenase (Fdh), to generate energy for the cell. The remaining formaldehyde is condensed with xylulose-5-phosphate by a third peroxisomal enzyme, dihydroxyacetone synthase (Dhas), to generate two three-carbon molecules that leave the peroxisome and enter a cyclic pathway that regenerates xylulose-5-phosphate and produces one net molecule of glyceraldehyde-3-phosphate for every three turns of this cycle (1, 57).Because three of the methanol pathway enzymes (Aox, Cat, and Dhas) are peroxisomal, the function of this organelle is also essential for methanol growth (21,26,33). This observation has made Pichia pastoris a major model system for the elucidation of peroxisome biogenesis and function (2,40,49). One advantage of P. pastoris for peroxisome studies is that in addition to methanol uti...

Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

“…To pursue this objective, β-galactosidase, the product of the bacterial lacZ gene, was used as reporter since it had been proven reliable for promoter induction studies in P. pastoris (Lin-Cereghino et al, 2006). The lacZ coding sequence was inserted into pPIC ZB (Invitrogen, Carlsbad, CA), a commercially available vector widely used for expression of recombinant intracellular proteins.…”

“…P. pastoris strain yJC100 (wild type) is a derivative of the original wild-type P. pastoris strain NRRL Y11430 (North Regional Research Laboratories, US Department of Agriculture, Peoria, IL) and has been described previously (Lin-Cereghino et al, 2006). yJC100 cells were cultured in either YPD medium (1% yeast extract, 2% peptone, and 2% glucose), YND (minimal medium with 1% dextrose) or YNM (minimal medium with 0.5% methanol) (Cregg and Madden, 1988; Cregg et al, 1985).…”

“…The coding sequence the lacZ gene was amplified from pGC181 (Lin-Cereghino et al, 2006) with the primers chriss5bgal2 CAAGAATTCATGCCAGGGGATCCCGTCGTT and 0103R CAAGCGGCCGCTTTTTGACACCAGACCAA. The resulting PCR fragment was restricted with the enzymes EcoR I and NotI and then ligated into the corresponding sites of pPICZB (Invitrogen Corp, Carlsbad, CA) to yield pCS1, the parent deletion plasmid.…”

“…β-galactosidase activity in cell free extracts was measured using standard protocols (Lin-Cereghino et al, 2006; Sambrook et al, 1989). …”

“…One key to its success is the alcohol oxidase 1 promoter ( AOX1 ), which is used to drive the expression of the recombinant protein (Ellis et al, 1985; Koutz et al, 1989). The AOX1 promoter is tightly repressed in cells grown in glucose medium but induced over 1000-fold in methanol medium (Lin-Cereghino et al, 2006). For expression of a specific recombinant protein, usually the coding sequence of the foreign gene is first inserted into a polylinker located between the AOX1 promoter with its 5′ untranslated region (5′UTR) and the AOX1 3′UTR of the expression cassette of a vector (Lin Cereghino et al, 2001).…”