Mutational Analysis of the <i>HIS4</i> Translational Initiator Region in <i>Saccharomyces cerevisiae</i>

Cigan, A. Mark; Pabich, E K; Donahue, Thomas F.

doi:10.1128/mcb.8.7.2964-2975.1988

Cited by 55 publications

(2 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This sequence, GAATTCCCATCTTGGGAATTC, is expected to form a stem-loop structure in the mRNA consisting of 8 bp (involving the underlined nucleotides) and five unpaired residues forming a loop (8). Sequences with potential secondary structures of similar predicted stabilities greatly inhibited translation of other yeast mRNAs (HIS4 and CYCJ) when introduced into the middle of the leader or just upstream from the AUG codon (1,2,6). Therefore, insertions of this sequence at any position in the GCN4 mRNA leader should inhibit GCN4 expression if initiation complexes must traverse the entire 591-nt leader to reach the GCN4 start codon.…”

Section: Resultsmentioning

confidence: 99%

Suppression of Ribosomal Reinitiation at Upstream Open Reading Frames in Amino Acid-Starved Cells Forms the Basis for GCN4 Translational Control

Abastado

Miller

Jackson

et al. 1991

Molecular and Cellular Biology

View full text Add to dashboard Cite

GCN4 encodes a transcriptional activator of amino acid-biosynthetic genes in Saccharomyces cerevisiae that is regulated at the translational level by upstream open reading frames (uORFs) in its mRNA leader. uORF4 (counting from the 5' end) is sufficient to repress GCN4 under nonstarvation conditions; uORF1 is required to overcome the inhibitory effect of uORF4 and stimulate GCN4 translation in amino acid-starved cells. Insertions of sequences with the potential to form secondary structure around uORF4 abolish derepression, indicating that ribosomes reach GCN4 by traversing uORF4 sequences rather than by binding internally to the GCN4 start site. By showing that wild-type regulation occurred even when uORF4 was elongated to overlap GCN4 by 130 nucleotides, we provide strong evidence that those ribosomes which translate GCN4 do so by ignoring the uORF4 AUG start codon. This conclusion is in accord with the fact that translation of a uORF4-lacZ fusion was lower in a derepressed gcd1 mutant than in a nonderepressible gcn2 strain. We also show that increasing the distance between uORF1 and uORF4 to the wild-type spacing that separates uORF1 from GCN4 specifically impaired the ability of uORF1 to derepress GCN4 translation. As expected, this alteration led to increased uORF4-lacZ translation in gcd1 cells. Our results suggest that under starvation conditions, a substantial fraction of ribosomes that translate uORF1 fail to reassemble the factors needed for reinitiation by the time they scan to uORF4, but become competent to reinitiate after scanning the additional sequences to GCN4. Under nonstarvation conditions, ribosomes would recover more rapidly from uORF1 translation, causing them all to reinitiate at uORF4 rather than at GCN4.

show abstract

Section: Resultsmentioning

confidence: 99%

Suppression of Ribosomal Reinitiation at Upstream Open Reading Frames in Amino Acid-Starved Cells Forms the Basis for GCN4 Translational Control

Abastado

Miller

Jackson

et al. 1991

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…As such, sequence elements within 5' TLs are important contributors to initiation efficiency and gene expression. Previous work demonstrated that features such as upstream open reading frames (uORFs), mRNA structures, and mRNA binding protein motifs influence the identification of the main start codon by the PIC (1)(2)(3)(4)(5)(6). These features have been studied largely independently, such that their relative importance in regulating gene expression from native 5' TLs has not been systematically evaluated in vivo.…”

Section: Introductionmentioning

confidence: 99%

Deciphering thecis-regulatory landscape of natural yeast Transcript Leaders

Akirtava,

May,

McManus

2024

Preprint

View full text Add to dashboard Cite

Protein synthesis is a vital process that is highly regulated at the initiation step of translation. Eukaryotic 5’ transcript leaders (TLs) contain a variety ofcis-regulatory features that influence translation and mRNA stability. However, the relative influences of these features in natural TLs are poorly characterized. To address this, we used massively parallel reporter assays (MPRAs) to quantify RNA levels, ribosome loading, and protein levels from 11,027 natural yeast TLsin vivoand systematically compared the relative impacts of their sequence features on gene expression. We found that yeast TLs influence gene expression over two orders of magnitude. While a leaky scanning model using Kozak contexts and uAUGs explained half of the variance in expression across transcript leaders, the addition of other features explained ∼70% of gene expression variation. Our analyses detected keycis-acting sequence features, quantified their effects in vivo, and compared their roles to motifs reported from anin vitrostudy of ribosome recruitment. In addition, our work quantitated the effects of alternative transcription start site usage on gene expression in yeast. Thus, our study provides new quantitative insights into the roles of TL cis-acting sequences in regulating gene expression.

show abstract

EIF2S3Mutations Associated with Severe X-Linked Intellectual Disability Syndrome MEHMO

et al. 2017

View full text Add to dashboard Cite

Impairment of translation initiation and its regulation within the integrated stress response (ISR) and related unfolded-protein response has been identified as a cause of several multi-systemic syndromes. Here we link MEHMO syndrome, whose genetic etiology was unknown, to this group of disorders. MEHMO is a rare X-linked syndrome characterized by profound intellectual disability, epilepsy, hypogonadism, and hypogenitalism, microcephaly, and obesity. We have identified a C-terminal frameshift mutation (Ile465Serfs) in the EIF2S3 gene in three families with MEHMO syndrome and a novel maternally inherited missense EIF2S3 variant (Ser108Arg) in another male patient with less severe clinical symptoms. The EIF2S3 gene encodes the γ subunit of eukaryotic translation initiation factor 2 (eIF2), crucial for initiation of protein synthesis and regulation of the ISR. Studies in patient fibroblasts confirm increased ISR activation due to the Ile465Serfs mutation and functional assays in yeast demonstrate that the Ile465Serfs mutation impairs eIF2γ function to a greater extent than tested missense mutations, consistent with the more severe clinical phenotype of the Ile465Serfs male mutation carriers. Thus, we propose that more severe EIF2S3 mutations cause the full MEHMO phenotype, while less deleterious mutations cause a milder form of the syndrome with only a subset of the symptoms.

show abstract

Mutational Analysis of the HIS4 Translational Initiator Region in Saccharomyces cerevisiae

Cited by 55 publications

References 42 publications

Suppression of Ribosomal Reinitiation at Upstream Open Reading Frames in Amino Acid-Starved Cells Forms the Basis for GCN4 Translational Control

Suppression of Ribosomal Reinitiation at Upstream Open Reading Frames in Amino Acid-Starved Cells Forms the Basis for GCN4 Translational Control

Deciphering thecis-regulatory landscape of natural yeast Transcript Leaders

EIF2S3Mutations Associated with Severe X-Linked Intellectual Disability Syndrome MEHMO

Contact Info

Product

Resources

About