Mutation landscape of SARS-CoV-2 reveals five mutually exclusive clusters of leading and trailing single nucleotide substitutions

Abstract

The COVID-19 pandemic is expanding at an unprecedented rate. As a result, diagnostic services are stretched to their limit, and there is a clear need for the provision of additional diagnostic capacity.Academic laboratories, many of which are closed due to governmental lockdowns, may be in a position to support local screening capacity by adapting their current laboratory practices. Here, we describe the process of developing a SARS-Cov2 diagnostic workflow in a conventional academic Containment Level 2 (CL2) laboratory. Our outline includes simple SARS-Cov2 deactivation upon contact, the methods for a quantitative real-time reverse transcriptase PCR (qRT-PCR) detecting SARS-Cov2, a description of process establishment and validation, and some considerations for establishing a similar workflow elsewhere. This was achieved under challenging circumstances through the collaborative efforts of scientists, clinical staff, and diagnostic staff to mitigate to the ongoing crisis. Within 14 days, we created a validated COVID-19 diagnostics service for healthcare workers in our local hospital. The described methods are not exhaustive, but we hope may offer support to other academic groups aiming to set up something comparable in a short time frame.

Conserved Genomic Terminals of SARS-CoV-2 as Co-evolving Functional Elements and Potential Therapeutic Targets

“…A very recent paper by Mishra et al identified two variant positions overlapping with this analysis in the 5’- and 3’-UTRs respectively (i.e. g.241C>T, g.29742G>A/T) ( 22 ). In this study, all UTR variants were located on predicted stem-loop structures with the exception of g.36C>T in the 5’-UTR.…”

“…5). The first of these three, CEVg2, was detected entirely within the N protein in 22.1% of the genomes. CEVg2 consisted of three consecutive variants g.28881G>A, g.28882G>A, g.28883G>C, which together led to two amino acid substitutions, p.R203K and p.G204R, and the change from one to two positively-charged residues.…”

Unsupervised clustering analysis of SARS-Cov-2 population structure reveals six major subtypes at early stage across the world

“…Despite the limited number of SARS-CoV-2 genome sequences, our work, as well as previous studies (55,56) that used clustering techniques to study the evolution of the SARS-CoV-2 virus, has shown to be a good supplement tool in phylogenetic analyses.…”

Whole Genome Identification of Potential G-Quadruplexes and Analysis of the G-Quadruplex Binding Domain for SARS-CoV-2

“…In addition, recent studies have detected high-frequency trinucleotide mutations (G28881A, G2882A, and G28883C) in the SARS-CoV-2 genome (Yao et al, 2020;Yin, 2020). G28881A and G28882A always co-occur within the same codon, which means a positive selection of amino acid (Mishra et al, 2020), but the consequence of the trinucleotide mutations was still elusive. We noticed that the trinucleotide mutations were in the G-rich sequence from 28,881 to 28,917 nt (5 ′ GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGG 3 ′ ).…”