Mutation in a homolog of yeast Vps53p accounts for the heat and osmotic hypersensitive phenotypes in Arabidopsis hit1-1 mutant

SummaryArabidopsis HIT4 is known to mediate heat-induced decondensation of chromocenters and release from transcriptional gene silencing (TGS) with no change in the level of DNA methylation. It is unclear whether HIT4 and MOM1, a well-known DNA methylation-independent transcriptional silencer, have overlapping regulatory functions.A hit4-1/mom1 double mutant strain was generated. Its nuclear morphology and TGS state were compared with those of wild-type, hit4-1, and mom1 plants. Fluorescent protein tagging was employed to track the fates of HIT4, hit4-1 and MOM1 in vivo under heat stress.HIT4-and MOM1-mediated TGS were distinguishable. Both HIT4 and MOM1 were localized normally to chromocenters. Under heat stress, HIT4 relocated to the nucleolus, whereas MOM1 dispersed with the chromocenters. hit4-1 was able to relocate to the nucleolus under heat stress, but its relocation was insufficient to trigger the decompaction of chromocenters. The hypersensitivity to heat associated with the impaired reactivation of TGS in hit4-1 was not alleviated by mom1-induced release from TGS.HIT4 delineates a novel and MOM1-independent TGS regulation pathway. The involvement of a currently unidentified component that links HIT4 relocation and the large-scale reorganization of chromatin, and which is essential for heat tolerance in plants is hypothesized.

“…Detailed procedures for medium preparation, seed sterilization, stratification, and germination were as described by Lee et al . () and Wang et al . ().…”

Section: Methodsmentioning

confidence: 91%

Arabidopsis HIT4, a regulator involved in heat‐triggered reorganization of chromatin and release of transcriptional gene silencing, relocates from chromocenters to the nucleolus in response to heat stress

Wang

Hsu

et al. 2014

“…To better understand plant HSRs and to identify genetic factors that dictate such responses, we have employed a forward genetics approach to screen for ethyl methane sulfonate (EMS)mutagenized Arabidopsis mutants that are more thermosensitive than the wild-type (Lee et al, 2006;Wu et al, 2010;Wang et al, 2011Wang et al, , 2013. One of these mutants, heat-intolerant 5-1 (hit5-1), was isolated because prolonged incubation at 37°C for 4 d was determined to be lethal to the mutant but not to wild-type seedlings.…”

Section: Introductionmentioning

confidence: 99%

The Arabidopsis heat‐intolerant 5 (hit5)/enhanced response to aba 1 (era1) mutant reveals the crucial role of protein farnesylation in plant responses to heat stress

Wang

Lin

et al. 2016

Protein farnesylation is a post-translational modification known to regulate abscisic acid (ABA)-mediated drought tolerance in plants. However, it is unclear whether and to what extent protein farnesylation affects plant tolerance to high-temperature conditions. The Arabidopsis heat-intolerant 5 (hit5) mutant was isolated because it was thermosensitive to prolonged heat incubation at 37°C for 4 d but thermotolerant to sudden heat shock at 44°C for 40 min. Map-based cloning revealed that HIT5 encodes the β-subunit of the protein farnesyltransferase. hit5 was crossed with the aba-insensitive 3 (abi3) mutant, the aba-deficient 3 (aba3) mutant, and the heat shock protein 101 (hsp101) mutant, to characterize the HIT5-mediated heat stress response. hit5/abi3 and hit5/aba3 double mutants had the same temperature-dependent phenotypes as hit5. Additionally, exogenous supplementation of neither ABA nor the ABA synthesis inhibitor fluridone altered the temperature-dependent phenotypes of hit5. The hit5/hsp101 double mutant was still sensitive to prolonged heat incubation, yet its ability to tolerate sudden heat shock was lost. The results suggest that protein farnesylation either positively or negatively affects the ability of plants to survive heat stress, depending on the intensity and duration of high-temperature exposure, in an ABA-independent manner. HSP101 is involved in the hit5-derived heat shock tolerance phenotype.

“…The ability of the seedlings to survive heat treatment was tested by incubating 10‐d‐old seedlings at 37°C for 4 d. This assay was used for genetic analysis (Lee et al. , 2006).…”

Section: Methodsmentioning

confidence: 99%

“…For reverse transcription PCR (RT‐PCR), cDNAs were amplified using the HIT2 ‐specific primers 5′‐GGGCAGCTGCGGATAATTCTCCCACCG‐3′ and 5′‐GACGCCGCTGCATGACTTGAGAACC‐3′. The poly‐ubiqui‐tin gene ( UBQ10 ) and a small HSP gene ( At‐HSP17.6A ) were also amplified with gene‐specific primers, described previously, as internal and positive controls, respectively (Lee et al. , 2006).…”

Section: Methodsmentioning

confidence: 99%

“…To identify genetic determinants that are essential for plant heat tolerance, we have employed a forward genetic approach to screen for heat-intolerant (hit) mutants of Arabidopsis after ethyl methanesulfonate (EMS) mutagenesis (Wu et al, 2000;Lee et al, 2006;Wang et al, 2008). One of these mutants, hit2, was isolated because its growth was inhibited under conditions of sustained high temperature.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Isolation and characterization of the Arabidopsis heat‐intolerant 2 (hit2) mutant reveal the essential role of the nuclear export receptor EXPORTIN1A (XPO1A) in plant heat tolerance

Wu¹,

Wang²,

Yeh

et al. 2010

Summary The Arabidopsis heat‐intolerant 2 (hit2) mutant was isolated on the basis of its impaired ability to withstand moderate heat stress (37°C). Determination of the genetic mutation that underlies the hit2 thermosensitive phenotype allowed better understanding of the mechanisms by which plants cope with heat stress. Genetic analysis revealed that hit2 is a single recessive mutation. Map‐based cloning was used to identify the hit2 locus. The response of hit2 to other types of heat stress was also investigated to characterize the protective role of HIT2. hit2 was defective in basal but not in acquired thermotolerance. hit2 was sensitive to methyl viologen‐induced oxidative stress, and the survival of hit2 seedlings in response to heat stress was affected by light conditions. The mutated locus was located at the EXPORTIN1A (XPO1A) gene, which encodes a nuclear transport receptor. Two T‐DNA insertion lines, xpo1a‐1 and xpo1a‐3, exhibited the same phenotypes as hit2. The results provide evidence that Arabidopsis XPO1A is dispensable for normal plant growth and development but is essential for thermotolerance, in part by mediating the protection of plants against heat‐induced oxidative stress.