Mulberry (Morus atropurpurea Roxb. ) leaf polyphenols inhibits adipogenesis and lipogenesis-related gene expression in 3T3-L1 adipocytes

Abstract

The effects of mulberry leaf polyphenols (MLPs) on the proliferation and differentiation of 3T3‐L1 preadipocytes were investigated in this study. No significant inhibitory effect on cell proliferation when MLP content was 10–50 μg/mL. MLP inhibited lipid accumulation in 3T3‐L1 preadipocytes dose‐dependently at concentrations of 0–50 μg/mL. The treatment of differentiating 3T3‐L1 cells with MLP at concentration of 40–50 μg/mL significantly inhibited the spillage of free fatty acids (FFAs), reduced the intracellular total triglyceride (TG) and cholesterol (TC) concentration. Furthermore, a decrease in mRNA expression of peroxisome proliferator activated receptor‐γ and CCAAT‐enhancer‐binding protein‐α, as well as fatty acid synthase and adiponectin were observed. This is the first study to demonstrate that MLP attenuated adipogenesis‐related mRNA expression of 3T3‐L1 preadipocytes. The findings suggested that MLP has complimentary potency for the regulation of obesity. Practical application The effects of MLP on the proliferation and differentiation of 3T3‐L1 preadipocytes were investigated for the first time in this study. MLP decreased FAA, TC, TG, lipid accumulation and attenuated adipogenesis‐related mRNA expression in differentiating 3T3‐L1 cells. The result clearly identified mulberry leaf supplements could be used as a nutraceutical agent to ameliorate obesity and its complications

Mulberry Leaf Polyphenols and Fiber Induce Synergistic Antiobesity and Display a Modulation Effect on Gut Microbiota and Metabolites

“…The MLPS extraction was harvested after freeze drying and the yield of MLPS extract was about 15 g with a polyphenols content of 20% in the extract as detected with Folin-reagent method. The high-performance liquid chromatography (HPLC) was carried out with our previous method [12].…”

Mulberry leaf phenolics and fiber exert anti‐obesity through the gut microbiota‐host metabolism pathway

“…The metabolic and anti‐obesity beneficial effects of mulberry leaves were first described in the Compendium of Materia Medica (Bencao Gangmu, 1590), and further confirmed under various experimental conditions (Ann et al., 2015; Hong et al., 2017; Li et al., 2018; Li et al., 2019a). Mulberry leaves are rich in various bioactive compounds, such as polyphenol, alkaloids, and polysaccharides, which are widely accepted as a beneficial material basis (Varghese & Thomas, 2019; Zhang et al., 2014).…”

“…Transcription of relevant factors was determined by real time PCR (RT‐qPCR) using LightCycer480 (Roche diagnostics Co., LTD., Shanghai, China). The synthesized cDNA was amplified by PCR using the following primers: PPAR‐γ , 5′‐CAGGAGCAGAGCAAAGAGGT‐3′ (forward), 5′‐TGGACACCATACTTGAGCAGA‐3′ (reverse); C/EBR‐α , 5′‐GCCAAGAAGTCGGTGGACA‐3′ (forward), 5′‐GTCTCCACGTTGCGTTGTTT‐3′ (reverse); FAS , 5′‐TGCCGAAGATGACGTTACTACT‐3′ (forward), 5′‐AGGTATGCTCGCTTCTCTGC‐3′ (reverse); Adiponectin , 5′‐CAGGAGCAGAGCAAAGAGGT‐3′ (forward), 5′‐CTCTCCAGGAGTGCCATCTCT‐3′ (reverse) (Li et al., 2018). Note that β‐actin gene was used as an internal reference for all samples.…”

An integrative multiomics approach to characterize anti‐adipogenic and anti‐lipogenic effects of Akkermansia muciniphila in adipocytes

“…The sequences of the PCR primers used in this study are shown in Table S1. [14][15][16][17][18][19] The qRT-PCR assay was performed using CFX Connect (Bio-Rad, CA, USA) with SsoAdvanced Universal SYBR Green Supermix (1725271, Bio-Rad, CA, USA). The qRT-PCR assay was performed under the following conditions: 40 cycles of denaturation at 95 • C for 20 s, annealing at 60 • C for 20 s, and extension at 72 • C for 20 s. The results were processed by CFX Maestro (Bio-Rad, CA, USA).…”

“…PPARγ, C/EBPα, FABP4, and adiponectin are involved in adipocyte differentiation mechanism and are generally recognized as major adipogenesis markers. [18,22] In addition, FASN and ACC1 play crucial roles in the production of fatty acids, such as palmitic acid. [23] In this study, we observed that the cell lysate of A. muciniphila downregulated these transcriptional markers of adipogenesis and lipogenesis.…”