Morpho-genetic diversity and anti-bacterial activity in root extracts of nine solanaceous species

Jeyakumar, Dhanushya T.; Silva, U. H. A. J. De; Dissanayake, D. R. R. P.; Chamikara, M. D. M.; Ranaweera, L. T.

doi:10.4038/tar.v28i1.8184

Cited by 3 publications

(6 citation statements)

References 45 publications

(40 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The purified DNA isolated from 13 wild and naturalized Solanum spp. in Sri Lanka were PCR amplified using matK primers (forward primer: 5 'CGA TCT ATT CAT TCA ATA TTT C 3' and reverse primer: 5" TCTAGCACACGAAAGTCGAAGT3") (Jeyakumar et al, 2016), the standard reagents, conditions and primer annealing temperature of 48 °C . The purified PCR products were subjected to Sanger DNA sequencing using ABI 3500 Genetic AnalyzerVersion 4405186.…”

Section: Dna Sequencingmentioning

confidence: 99%

“…The purified PCR products were subjected to Sanger DNA sequencing using ABI 3500 Genetic AnalyzerVersion 4405186. The obtained matK DNA sequences of these 13 species were published in Jeyakumar et al, (2016) in comparison to the morphogenetic diversity structureof the species (Table 1, GenBank Accession Numbers KX258741 to KX258754). The same dataset was used in the present analysis to estimate the origination events of these species.…”

Section: Dna Sequencingmentioning

confidence: 99%

“…Sri Lanka is one of the biodiversity hot spots in the world (Bossuyt et al, 2004) and is home to 15 wild / naturalized and 13 exotic Solanum species (Dassanayake, 1987) and many of them are found in abundance in nearby India. These Solanum species possess valuable economic potential as edible and medicinal plants (Jeyakumar et al, 2016). Different parts of the wild Solanum plants exhibit important medicinal properties including anti-diabetic (Gupta et al, 2005), anticonvulsant (Adesina, 1985), anticancer (Jain et al, 2011), antibacterial (Salar, 2009;Doss et al, 2009), and wound healing properties (Huang et al, 2008) as well as larvicidal activity against mosquitoes (Bansal et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Phylogeographic and phylogenetic analyses of selected set of wild and naturalized Solanum spp. in Sri Lanka

2018

Self Cite

View full text Add to dashboard Cite

Solanum spp. encompass a greater share of the biodiversity in the world. Sri Lanka, one of the biodiversity hotspots in the world, is the home for wide range of Solanum spp. which have been named and morphologically characterized. However, their origins and times of origin have not yet been resolved. Hence, this study was conducted to identify the origins and origination events of 13 wild and naturalized Solanum spp. found in Sri Lanka, using DNA barcoding locus matK in comparison to worldwide Solanum spp. with phylogenetics and divergence dating approaches. In this study, 13 Sri Lankan Solanum spp. were separated into four defined phylogenetic groups viz., Old world, Morelloids, Acanthophora and Trova. The studied Sri Lankan Solanum spp. would have been originated in Africa 2.007 million years ago (MYA) in the Pleistocene epoch through mammalian migration from Mediterranean land bridges. The Australian relatives of Sri Lankan Solanum spp. would have been colonized from South Asia through South East Asia. The floristic connectivity in Pleistocene epoch may have introduced Asian Solanum spp. to South East Asia where mid Miocenic collisions between Australian and Asian plates as well as over water Long Distance Dispersal (LDD) may have caused these species to colonize in Australia. Our analysis demonstrated that most of the Solanum spp. found in Sri Lanka were introduced from India during the Pleistocene ice age. We suggest that Pre Pleistocene migrations of Solanum spp. such as S. nigrum may have occurred through overwater LDD.

show abstract

Section: Dna Sequencingmentioning

confidence: 99%

Section: Dna Sequencingmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Phylogeographic and phylogenetic analyses of selected set of wild and naturalized Solanum spp. in Sri Lanka

2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…Finally, the resemblance of Bayesian and ML trees was modelled, and the posterior probability values were incoporated to the nodes of the Bayesian tree. Jeyakumar et al (2016) and Bello et al (2013) showing higher genetic determination in the considered traits.…”

Section: Phylogenetic Analysismentioning

confidence: 75%

“…The members of the family Solanaceae are well known for the remarkable medicinal properties found in leaves, fruits and roots (Jeyakumar et al, 2016). The fruits of Solanum torvum Swartz are used as a cure for cough, liver and spleen disorders (Siemonsma and Piluek, 1994).…”

Section: Introductionmentioning

confidence: 99%

Diversity analysis of Selected Solanum species in Sri Lanka using molecular and morphological descriptors

et al. 2019

Self Cite

View full text Add to dashboard Cite

The family Solanaceae is composed of a broad list of species, which includes both commercial and wild accessions with enormous medicinal importance. The published phylogenies on Sri Lankan wild and naturalized Solanum spp. confers that S. hispidum, and S. torvum are sister species. However, this has not been proved using multiple barcoding markers. Moreover, S. torvum, an underutilized crop is expected to contain multiple varieties. However, varietal descriptions using morphological and DNA markers have not been done so far. Therefore, our study was aimed at accurate identification of four Solanum spp. found in Sri Lanka (S. torvum 'Bindu' and landraces S. hispidum and S. pubescens) using chloroplast marker based DNA barcoding combined with a morphological description. We used 29 quantitative and 22 qualitative parameters, comprised of vegetative and reproductive traits along with eight DNA barcoding markers. We sequenced rbcL and trnL-F to check the DNA polymorphisms. According to the combined morphological analysis of reproductive and vegetative parameters, the four species clustered separately. There were no separation observed between S. torvum and S. hispidum. Solanum pubescens diverged out and cladded with old world nightshades in molecular analysis. These results are in line with published literature and validates that trnL-trnF could be used as a potential marker to carry out a combined DNA barcoding analysis with matK. However, trnL-trnF could not be used to discriminate between S. torvum and S. hispidum species.

show abstract

Chinese medicinal herb extract inhibits PQS-mediated quorum sensing system in Pseudomonas aeruginosa

Wei¹,

Bhasme

Wang³

et al. 2020

Journal of Ethnopharmacology

View full text Add to dashboard Cite

Morpho-genetic diversity and anti-bacterial activity in root extracts of nine solanaceous species

Abstract: The family Solanaceae is immensely important because it has many species

Cited by 3 publications

References 45 publications

Phylogeographic and phylogenetic analyses of selected set of wild and naturalized <em>Solanum</em> spp. in Sri Lanka

Phylogeographic and phylogenetic analyses of selected set of wild and naturalized <em>Solanum</em> spp. in Sri Lanka

Diversity analysis of Selected <em>Solanum</em> species in Sri Lanka using molecular and morphological descriptors

Chinese medicinal herb extract inhibits PQS-mediated quorum sensing system in Pseudomonas aeruginosa

Contact Info

Product

Resources

About