Molecular diversity of native rhizobia trapped by five field pea genotypes in Indian soils

Abstract

Five pea cultivars; HFP 4, HVP 3-5, HFP 9426, Jayanti and Hariyal, being grown in CCS Haryana Agricultural University farm were used to isolate native rhizobia. Selected 54 rhizobia, from all cultivars, were authenticated as rhizobia by plant infectivity test. Along with nodulation, symbiotic effectiveness in terms of symbiotic ratios showed wide range of effectiveness of pea rhizobia from 1.11 to 5.0. DNA of all the 54 rhizobia was extracted and amplified by PCR, using ERIC and 16S rDNA primers. Dendrogram based on ERIC profiles of these 54 rhizobia showed the formation of 13 subclusters at 80% level of similarity. Dendrogram based on RFLP of 16S rDNA by three restriction endonucleases; Msp I, Csp 6I and Rsa I; also formed 13 subclusters at 80% level of similarity. However, positioning of subclusters was different from that of ERIC based dendrogram. Majority of the isolates i.e. 64.8% by ERIC profiles and 44.4% by RFLP of 16S rDNA formed one cluster. Isolates from same nodule were not 100% similar. Considering each cluster representing a rhizobial genotype, both techniques used to assess molecular diversity indicated the presence of 13 genotypes of field pea rhizobia in CCS Haryana Agricultural University farm soil. Two pea rhizobial genotypes were able to nodulate all the five pea cultivars. Furthermore, high strain richness index (0.43-0.5) of field pea rhizobia was observed by both the techniques.

Isolation, characterization, and evaluation of bacterial root and nodule endophytes from chickpea cultivated in Northern India

“…To isolate endophytes the roots and nodules were surface sterilized by using 0.2% mercuric chloride and ethanol and then rinsed with sterile water four to six times . Roots were crushed for isolation of endophytes whereas a cut was made in the nodules with a sterilized knife and then a loop ful of root and nodule sap was streaked on separate Tryptone Soya Agar (TSA) medium plates . The plates were incubated at 28 ± 2 °C for 5–6 days.…”

“…Further all the endophytic isolates were inoculated separately in Tryptone soya broth and incubated on rotary shaker at 28 ± 2 °C. Germinated chickpea seedlings of variety HC5 were transferred to sterilized cups containing sand as detailed earlier . Seedlings were inoculated with 1–2 ml broth of Mesorhizobium sp.…”

“…Amplification of 16S rDNA of root and nodule endophytes was carried out using bacterial DNA as templates with primers fD1 (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and rD1 (5′‐AAGGAGGTGATCCAGCCGCA‐3′) . PCR amplification was carried out by modifying the protocol as described earlier . PCR was carried out in 23.5 µl volume per reaction.…”

Diversity of Rhizobia Nodulating Faba Bean (Vicia faba) Growing in Egypt

“…The ancestral lifestyle of rhizobia was probably rhizospheric, and the degradative capabilities of rhizospheric bacteria have been highlighted [3]. It is well known that crop plants belonging to the genera Vicia, Lathyrus, Pisum and Lens are effectively nodulated by isolates of Rhizobium leguminosarum biovar viciae [4]. The symbiotic interaction between rhizobia and legumes is initiated by an exchange of complex molecular signals that confer host-specificity.…”

Molecular diversity of berseem (<italic>Trifolium alexandrinum</italic> L.) rhizobia isolated from Haryana soil

“…Subgroup II was having only one isolate (BH44) which further showed that this isolate is different from all the other members of major group I. Isolates BH13 and BH52 showed 100% similarity among themselves and the same was observed for BH36 and BK81; BS12, BK76 and BK51; BS14 and BH16. However, it was observed that 100% similarity was not shown by rhizobia isolated from nodules of the same plants as also reported by Wadhwa et al, (2011). Similarly, large number of groups and further subgroups of rhizobia infecting different legumes have been reported in different parts of the world, revealing considerable molecular diversity (Nandwani and Dudeja, 2009;De Meyer et al, 2011;Choudhary et al, 2013 Table 2.…”