Molecular Characterization of Clostridium difficile Isolates in China From 2010 to 2015

Liu, Xiao-Shu; Li, Wenge; Zhang, Wenzhu; Wu, Yuan; Lu, Jinxing

doi:10.3389/fmicb.2018.00845

Cited by 37 publications

(28 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Geographical heterogeneity and transcontinental dissemination have aroused more concerns about regional CDI surveillance. In China, although the state of dilemma introduced by CDI has been documented before [6,7], data are lacking in the central and western regions. To fill gaps in the epidemiological territory of CDI in China, the results in this study presented basic knowledge of the prevalence and mortality of HA-CDI, and helped to improve the recognition of patients at high risk for HA-CDI Fig.…”

Section: Discussionmentioning

confidence: 99%

“…However, unlike the rest of East Asia, limited data have focused on the burden of CDI in China. Although few regional studies alarmed that the hyper-virulent C. difficile strain ST-1 (BI/NAP1/027), an epidemic strain in Europe and North America, has emerged in Chinese hospital settings, recent reports revealed that ST35, ST37 and ST3 were the most prevalent genotypes in mainland China [6,7]. Moreover, in consideration of the complex personnel mobility in medical institutions, the majority of CDI is hospital-acquired, and nosocomial transmission of C. difficile contributes greatly to the spread of different genotypes.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Characteristics of Clostridium difficile isolates and the burden of hospital-acquired Clostridium difficile infection in a tertiary teaching hospital in Chongqing, Southwest China

Dai

TianXiang²,

Yan

et al. 2020

BMC Infect Dis

View full text Add to dashboard Cite

Background: Clostridium difficile infection (CDI), especially hospital-acquired Clostridium difficile infection (HA-CDI), continues to be a public health problem and has aroused great concern worldwide for years. This study aimed to elucidate the clinical and epidemiological features of HA-CDI and the characteristics of C.difficile isolates in Chongqing, Southwest China.Methods: A case-control study was performed to identify the clinical incidence and risk factors of HA-CDI. C. difficile isolates were characterised by polymerase chain reaction (PCR) ribotyping, multilocus sequence typing (MLST), toxin gene detection and antimicrobial susceptibility testing.Results: Of the 175 suspicious patients, a total of 122 patients with antibiotic-associated diarrhea (AAD) were included in the study; among them, 38 had HA-CDI. The incidence of AAD and HA-CDI was 0.58 and 0.18 per 1000 patient admissions, respectively. Chronic renal disease and cephalosporin use were independent risk factors for HA-CDI. Fifty-five strains were assigned into 16 sequence types (STs) and 15 ribotypes (RTs). ST2/RT449 (8, 14.5%) was the predominant genotype. Of the 38 toxigenic isolates, A + B + CDT-isolates accounted for most (34, 89.5%) and 1 A + B + CDT+ isolate emerged. No isolate was resistant to vancomycin, metronidazole or tigecycline, with A-B-CDTbeing more resistant than A + B + CDT-.Conclusions: Different genotypes of C. difficile strains were witnessed in Chongqing, which hinted at the necessary surveillance of HA-CDI. Adequate awareness of patients at high risk of HA-CDI acquisition is advocated and cautious adoption of cephalosporins should be highlighted.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Characteristics of Clostridium difficile isolates and the burden of hospital-acquired Clostridium difficile infection in a tertiary teaching hospital in Chongqing, Southwest China

Dai

TianXiang²,

Yan

et al. 2020

BMC Infect Dis

View full text Add to dashboard Cite

show abstract

“…1 ml of enrichment broth was alcohol shocked with an equal volume of absolute ethanol for 1 h. A volume of 100 μl supernatant was plated directly on selective cycloserine-cefoxitin-fructose agar plates (CCFA, Oxoid, UK) with 5% egg yolk after ethanol shock treatment and incubated in an anaerobic jar at 37°C for 48 h. Isolation of C. difficile was based on previously described methods, suspected colonies were further confirmed by the 16S rRNA gene [41]. All colonies were cultured on anaerobic medium in an anaerobic environment at 37°C.…”

Section: Isolation Of C Difficilementioning

confidence: 99%

“…The methods of MLST, toxin genes profile and PCR-Ribotyping was obtained according to previously reported [13,41]. The primers and the amplification conditions used for PCR ribotyping have been described previously [42].…”

Section: Multilocus Sequence Typing (Mlst) Toxin Gene Profile and Pmentioning

confidence: 99%

The molecular characters and antibiotic resistance of Clostridioides difficile from economic animals in China

Zhang

Liu

et al. 2020

BMC Microbiol

Self Cite

View full text Add to dashboard Cite

Background: It has been performed worldwidely to explore the potential of animals that might be a reservoir for community associated human infections of Clostridioides difficile. Several genetically undistinguished PCR ribotypes of C. difficile from animals and human have been reported, illustrating potential transmission of C. difficile between them. Pig and calf were considered as the main origins of C. difficile with predominant RT078 and RT033, respectively. As more investigations involved, great diversity of molecular types from pig and calf were reported in Europe, North American and Australia. However, there were quite limited research on C. difficile isolates from meat animals in China, leading to non-comprehensive understanding of molecular epidemiology of C. difficile in China. Results: A total of 55 C. difficile were isolated from 953 animal stool samples, within which 51 strains were from newborn dairy calf less than 7 days in Shandong Province. These isolates were divided into 3 STs and 6 RTs, of which ST11/RT126 was predominant type, and responsible for majority antibiotic resistance isolates. All the isolates were resistant to at least one tested antibiotics, however, only two multidrug resistant (MDR) isolates were identified. Furthermore, erythromycin (ERY) and clindamycin (CLI) were the two main resistant antibiotics. None of the isolates were resistant to vancomycin (VAN), metronidazole (MTZ), tetracycline (TET), and rifampin (RIF). Conclusions: In this study, we analyzed the prevalence, molecular characters and antibiotic resistance of C. difficile from calf, sheep, chicken, and pig in China. Some unique features were found here: first, RT126 not RT078 were the dominant type from baby calf, and none isolates were got from pig; second, on the whole, isolates from animals display relative lower resistant rate to these 11 tested antibiotics, compared with isolates from human in China in our previous report. Our study helps to deep understanding the situation of C. difficile from economic animals in China, and to further study the potential transmission of C. difficile between meat animals and human.

show abstract

“…The concentration of the extracted DNA was determined using NanoDrop (ThermoScientific, Wilmington, DE, USA). PCR was performed using primers specific for toxins A and B (TcdA2), TcdC (TNC), and the 16S ribosomal RNA gene (16S rRNA) as control ( Fiedoruk et al, 2015 ; Fry et al, 2012 ; Griffiths et al, 2010 ; Lemee et al, 2004 ; Li et al, 2017 ; Liu et al, 2018 ; Murray et al, 2009 ). The sequences of the primers used are: TcdA2 F-50AGATTCCTATATTTACATGACAATAT30, R- 5´GTATCAGGCATAAAGT AATATACTTT3´; TNC F- 5´GAGCACAAAGGGTATTGCTCTACTGGC3´, R- 5´CCAGACACAGCTAATCTTATTTGCACCT3´; 16S rRNA F- 5´ACACG GTCCAAACTCCTACG3´, R-5´AGGCGAGTTTCAGCCTACAA3´.…”

Section: Methodsmentioning

confidence: 99%

High rate of Clostridium difficile among young adults presenting with diarrhea at two hospitals in Kenya

Oyaro

Plants-Paris²,

Bishoff³

et al. 2018

International Journal of Infectious Diseases

View full text Add to dashboard Cite

Background: Clostridium difficile infection (CDI) is the leading cause of antibiotic-associated diarrhea worldwide. As a result, the US Centers for Disease Control and Prevention have designated C. difficile as an urgent threat. Despite the global public health risk posed by CDI, little is known about its epidemiology on the African continent. This article describes the common occurrence of CDI from a cross-section of consecutively seen, randomly enrolled patients presenting with diarrhea at two major hospitals in Kenya. Methods: Patients presenting with diarrhea at two major hospitals in Kenya from May to July 2017 were enrolled. After signing the informed consent, stool samples, demographic data, medical history, prior antibiotic use, and HIV status were obtained from the patients. C. difficile was detected and validated by toxigenic culture and PCR. Results: The average age of the patients was 35.5 years (range 3–86 years); 59% were male and 41% were female. Out of 105 patient s tools tested, 98 (93.3%) were positive for C. difficile by culture. PCR analysis confirmed C. Difficile-specific genes, tcdA, tcdB, and tcdC, in the strains isolated from the stools. Further, 82.5% of the stools had C. difficile isolates bearing the frame-shift delection associated with hypervirulent strains. Remarkably, 91.9% of the stools that tested positive for C. difficile came from patients under 60 years old, with 64.3% being less than 40 years of age.The majorityof the patients (85%) reported over-the-counter antibiotic use in the last 30 days before the hospital visit. Conclusions: Together, the results revealed an unusually high incidence of C. difficile in the stools analyzed, especially among young adults who are thought to be less vulnerable. Comprehensive research is urgently needed to examine the epidemiology, risk factors, pathogenesis, comorbidities, clinical outcomes, antibiotic susceptibility, and genetic makeup of C. difficile strains circulating on the African continent.

show abstract

Molecular Characterization of Clostridium difficile Isolates in China From 2010 to 2015

Cited by 37 publications

References 41 publications

Characteristics of Clostridium difficile isolates and the burden of hospital-acquired Clostridium difficile infection in a tertiary teaching hospital in Chongqing, Southwest China

Characteristics of Clostridium difficile isolates and the burden of hospital-acquired Clostridium difficile infection in a tertiary teaching hospital in Chongqing, Southwest China

The molecular characters and antibiotic resistance of Clostridioides difficile from economic animals in China

High rate of Clostridium difficile among young adults presenting with diarrhea at two hospitals in Kenya

Contact Info

Product

Resources

About