Molecular characterisation of Meloidogyne enterolobii and other Meloidogyne spp. from South Africa

Rashidifard, Milad; Marais, Mariette; Daneel, M.; Mienie, Charlotte; Fourie, Hendrika

doi:10.1007/s40858-019-00281-4

Cited by 30 publications

(26 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNA from previously selected living males and females was extracted using chelex-100 as described by Rashidifard et al (2019) . Polymerase chain reaction (PCR) conditions followed the protocol of Swart et al (2020) with the following DNA markers used for DNA amplification: 28 S rDNA: D2A (5–ACAAGTACCGTGAGGGAAAGTTG–3), D3B (5–TCGGAAGGAACCAGCTACTA–3) ( Subbotin et al, 2006 ), and 18 S rDNA: SSU F04 (GCTTGTCTCAAAGATTAAGCC), SSU R26 (CATTCTTGGCAAATGCTTTCG) ( Blaxter et al, 1998 ).…”

Section: Methodsmentioning

confidence: 99%

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Marais¹,

Berg²,

Fourie

et al. 2020

Journal of Nematology

Self Cite

View full text Add to dashboard Cite

In the summer of 2018, specimens of a Hoplolaimus population were extracted from a maize root sample collected near Stampriet, Namibia. This population was identified as Hoplolaimus pararobustus and is described and illustrated based on its morphological, morphometric, and molecular characteristics. To our knowledge, this is the first report H . pararobustus from maize roots. Females of the population had a mean body and stylet length of 1,100 µm and 36 µm, respectively. Esophagus with three nuclei in three pharyngeal glands. Lateral field reduced, ranging from a very faint line to just breaks in striae. The males were shorter than the females with a mean body length of 925 µm and the stylet slightly shorter, with a mean length of 34 µm. Phylogenetic analyses using partial sequences of 18 S and the expansion fragment D2–D3 of 28 S rDNA genes showed the close relation of this species and H. columbus . This Namibian population of H. pararobustus is the first Hoplolaimus species from Africa to be molecularly characterized.

show abstract

Section: Methodsmentioning

confidence: 99%

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Marais¹,

Berg²,

Fourie

et al. 2020

Journal of Nematology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Fixed specimens in DESS were rinsed using double-distilled water, and two specimens were transferred to individual 1.5 ml tubes containing 15 μl nuclease-free water. DNA were extracted using chelex-100 by adding 20 μl of chelex (5% w/v) and 5 μl proteinase K to each tube, followed by incubation at 57°C for 120 min and at 95°C for 10 min (Rashidifard et al ., 2019).…”

Section: Methodsmentioning

confidence: 99%

Morphological and molecular characterization ofAporcella feminasp. n. (Dorylaimida, Aporcelaimidae) from Nigeria

et al. 2021

Self Cite

View full text Add to dashboard Cite

A new species of the genus Aporcella collected from a watermelon field in Nigeria is described, including its morphological and molecular (small subunit (SSU) and large subunit (LSU) ribosomal DNA (rDNA)) characterization. Aporcella femina sp. n. is distinguished by its 3.21–3.64 mm-long body, inner cuticle layer with fine but distinct transverse striation, lip region offset by deep constriction, 22–25 μm broad, odontostyle 20–26 μm, neck 661–811 μm long, pharyngeal expansion occupying 52–56% of the total neck length, female genital system didelphic–amphidelphic, uterus 191–350 μm or 1.9–3.3 mid-body diameters long, V = 52–57, tail short and convex conoid (35–48 μm, c = 72–98, c′ = 0.7–0.9) and males absent. Phylogenetic analyses based on the partial sequence of SSU and LSU (D2–D3) rDNA revealed a close relationship of A. femina sp. n. with other Aporcella species, confirming the monophyly of the genus as well as its association to a clade made of several taxa characterized by the absence of pars refringens vaginae.

show abstract

“…Genomic DNA was extracted from a single female specimen using the modified Chelex method as described by Rashidifard et al (2019) . The DNA was amplified using the following reagents: 12.5 µl master mix (Promega), 4 µl of specimen’s DNA, 1 µl of forward and reverse primers (10 µM), and 6.5 µl of ddH2O in a Vacutec thermocycler machine ( www.vacutec.co.za ).…”

Section: Methodsmentioning

confidence: 99%

Description of Prionchulus jonkershoekensis n. sp. (Nematoda: Mononchida), a new predatory species from South Africa

Rensburg

Fourie

Ashrafi

et al. 2021

Journal of Nematology

Self Cite

View full text Add to dashboard Cite

Prionchulus jonkershoekensis n. sp. is described from South Africa and illustrated using morphological, morphometric, and molecular techniques. This species is characterized by its body length (1.78-2.14 mm); the size of buccal cavity (38-44 × 24-31 µm), lower dorsal tooth position in relation to buccal cavity base, the position of amphidial aperture just above dorsal tooth apex, pars proximalis vaginae with almost straight walls, and tail 144-158 µm long with sickle shaped posterior third part. Phylogenetic analyses based on 18 S rDNA and 28 S rDNA of P. jonkershoekensis n. sp. revealed close relationships of the new species with Prionchulus punctatus and Prionchulus muscorum. This is also an additional geographical record for the genus from South Africa.

show abstract

Molecular characterisation of Meloidogyne enterolobii and other Meloidogyne spp. from South Africa

Cited by 30 publications

References 37 publications

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Morphological and molecular characterization ofAporcella feminasp. n. (Dorylaimida, Aporcelaimidae) from Nigeria

Description of Prionchulus jonkershoekensis n. sp. (Nematoda: Mononchida), a new predatory species from South Africa

Contact Info

Product

Resources

About