Modular total syntheses of mycolactone A/B and its [²H]-isotopologue

Abstract

A modular total synthesis of mycolactone A/B, the exotoxin produced by Mycobacterium ulcerans, has been achieved through the orchestration of several Pd-catalyzed key steps. While this route leads to a mixture of the natural product and its C12 epimer (4 : 1 ratio), this was inconsequential from the biological activity standpoint. Compared to the previously reported routes, this synthetic blueprint allows the late-stage modification of the toxin, as exemplified by the preparation of [22,22,22-H]-mycolactone A/B.

Structure of the Inhibited State of the Sec Translocon

“…2014 CAS: 1000770-96-6 Ipomoeassin F Cao et al. 2007 ; Zong et al., 2019 CAS:915392-44-8 Resazurin sodium salt Sigma Aldrich Cat#R7017, CAS:62758-13-8 Mycolactone A/B, mixture of epimers at C12 Saint-Auret et al., 2017a , 2017b N/A Paraformaldehyde Sigma Aldrich Cat#P6148 Deposited Data Canine ribosome:Sec61 complex cryo-EM map in the presence of mycolactone This paper EMDB: 11064 Canine Sec61 channel bound to mycolactone model coordinates This paper PDB: 6Z3T Canine ribosome:Sec61 complex cryo-EM map in the absence of mycolactone This paper EMDB: 11064 Original images and immunoblots, Sanger sequencing, viability assays and LC-MS data This paper https://data.mendeley.com/datasets/cc92fyz9sv/1 Experimental Models: Cell Lines HCT-116 cell line ATCC CCL-247 TRex-293 cell line Thermo Fisher R71007 TRex-293 Sec61α S71F C-terminal Flag This paper N/A TRex-293 Sec61α G80W C-terminal Flag This paper N/A TRex-293 Sec61α S82Y C-terminal Flag This paper N/A Oligonucleotides Sec61A1_frag1F TAGCACTGACGTGTCTCTCG Sigma Aldrich N/A Sec61A1_frag1R TCCCCATACATCCCGGTCAT Sigma Aldrich N/A Sec61A1_frag2F CTTCAACGGAGCCCAAAAGT Sigma Aldrich N/A Sec61A1_frag2R GTGTTGTACT...…”

“…For selection of stably transfected TRex-293 cells to derive overexpressing mycolactone resistance mutations, we used synthetic mycolactone A/B as a mixture of epimers at C12′, kindly provided by Dr Nicolas Blanchard ( Saint-Auret et al., 2017a , 2017b ) (French National Centre for Scientific Research), which is available in the greater amounts needed for cells under selection. However, tests performed with stable clones used mycolactone A/B ( Song et al., 2002 ).…”

“…The plasmid was digested with MluI and 2 μg transfected into TRex-293 cells (Thermo Fisher) with Fugene (Promega) according to the manufacturer’s instructions. Cells were selected for one week in the presence of 10 ng/ml (13.5 nM) mycolactone epimers (kind gift from Dr Nicolas Blanchard, CRNS France) ( Saint-Auret et al., 2017a , Saint-Auret et al., 2017b ) and then for 1 week with 600 μg/ml hygromycin (Thermo Fisher). Expression of the mutant gene was confirmed by immunoblotting, and/or immunofluorescence, for the Flag tag.…”

Mycobacterium ulcerans mycolactones-fungi crosstalking

“…shinshuense , Mycobacterium pseudoshottsii and Mycobacterium liflandii 3–8 . In addition to its natural production, mycolactone A/B has also undergone total synthesis 1,9 .…”

Stereoselective Construction of (E,Z)‐1,3‐Dienes and Its Application in Natural Product Synthesis

“…In the total syntheses of mycolactones A and B, Blanchard described the visible-light photoisomerisation of the pentadienyl system of 182 to give a 1:1 mixture of the E,Z-double bond at the C4-C5 junction of 183, found in the natural source (Scheme 71). [165,166] In another study of the total synthesis of marinisporolide C, Dias observed a serendipitous isomerisation during the last step. Starting from tetraene 184 (with only E-configurations), an HWE intramolecular reaction, followed by alcohol deprotection, resulted in the formation of macrocyclic pentaene 185 with E to Z isomerisation of the C15-C16 double bond (Scheme 72).…”