Mitochondrial phylogeography and demographic history of the Vicuña: implications for conservation

Abstract

6Private Veterinary Practice, Lima, PeruThe vicuñ a (Vicugna vicugna;Miller, 1924) is a conservation success story, having recovered from near extinction in the 1960s to current population levels estimated at 275 000. However, lack of information about its demographic history and genetic diversity has limited both our understanding of its recovery and the development of science-based conservation measures. To examine the evolution and recent demographic history of the vicuñ a across its current range and to assess its genetic variation and population structure, we sequenced mitochondrial DNA from the control region (CR) for 261 individuals from 29 populations across Peru, Chile and Argentina. Our results suggest that populations currently designated as Vicugna vicugna vicugna and Vicugna vicugna mensalis comprise separate mitochondrial lineages. The current population distribution appears to be the result of a recent demographic expansion associated with the last major glacial event of the Pleistocene in the northern (18 to 221S) dry Andes 14-12 000 years ago and the establishment of an extremely arid belt known as the 'Dry Diagonal' to 291S. Within the Dry Diagonal, small populations of V. v. vicugna appear to have survived showing the genetic signature of demographic isolation, whereas to the north V. v. mensalis populations underwent a rapid demographic expansion before recent anthropogenic impacts.

The influence of the aridAndean high plateau on the phylogeography and population genetics of guanaco (Lama guanicoe) inSouthAmerica

“…The left domain of the mitochondrial control region (514 bp) was amplified using the camelid and guanaco specific primers LthrArtio (5′‐GGT CCT GTA AGC CGA AAA AGG A‐3′), H15998V (5′‐CCA GCT TCA ATT GAT TTG ACT GCG‐3′), HLoop550G: 5′ ATG GAC TGA ATA GCA CCT TAT G 3′ (Marin et al . ). Amplification was performed in a 50 μL reaction volume with ~30 ng genomic DNA, 1x PCR buffer (8 m m Tris‐HCl (pH 8.4); 20 m m KCl (InvitrogenGibco, Life Technologies), 2 m m MgCl 2 , 25 μ m each of dNTP, 0.5 μ m each primer and 0.1U/μ Taq polymerase (InvitrogenGibco, Life Technologies ® ).…”

Application of DNA Forensic Techniques for Identifying Poached Guanacos (Lama guanicoe) in Chilean Patagonia*

“…To identify the species from the samples, polymerase chain reaction (PCR) amplification was performed using a partial sequence of cytochrome b gene and the primer: LGlu ARTIO: 5′‐TCTAACCACGACTAATGACATG‐3′ and HThr ARTIO: 5′‐TCCTTTTTCGGCTTACAAGACC‐3′ (12). These primers were designed by aligning consensus sequences obtained from domestic ungulate taxa available in GeneBank (25) and located in the tRNA for glutamine and the tRNA for tryptophan, respectively.…”

A three-step approach to minimise the impact of a mining site on vicuña (Vicugna vicugna) and to restore landscape connectivity

“…), where it inhabits the cold, dry and almost plantless antiplanos (Franklin 2011). The subspecies in the study area is V. V. vicugna (B. González, personal communication), which occurs south of latitude 18°S, and is less abundant than the V. v. mensalis to the north (Marín et al 2007;Lichtenstein et al 2008). The species is categorised as of 'Least concern' by the International Union for the Conservation of Nature (IUCN); however, populations in Chile are protected under the national 'Endangered' category (Lichtenstein et al 2008;MMA 2015), with over 95 % of individuals being concentrated in the Arica-Parinacota Region, bordering Perú.…”