Mitochondrial minicircles in the free-living bodonid Bodo saltans contain two gRNA gene cassettes and are not found in large networks

Abstract

In trypanosomatids, the majority of the guide (g) RNAs that provide the information for U-insertion/deletion RNA editing are encoded by minicircles that are catenated into large networks. In contrast, in the distantly related cryptobiid Trypanoplasma borreli, gRNA genes appear to reside in large 180-kb noncatenated DNA circles. To shed light on the evolutionary history and function of the minicircle network, we have analyzed minicircle organization in the free-living bodonid Bodo saltans, which is more closely related to trypanosomatids than T. borreli. We identified 1.4-kb circular DNAs as the B. saltans equivalent of minicircles via sequence analysis of 4 complete minicircles, 14 minicircle fragments, and 14 gRNAs. We show that each minicircle harbors two gRNA gene cassettes of opposite polarity residing in variable regions of about 200 nt in otherwise highly conserved molecules. In the conserved region, B. saltans minicircles contain a putative bent helix sequence and a degenerate dodecamer motif (CSB-3). Electron microscopy, sedimentation, and gel electrophoresis analyses showed no evidence for the existence of large minicircle networks in B. saltans, the large majority of the minicircles being present as circular and linear monomers (85-90%) with small amounts of catenated dimers and trimers. Our results provide the first example of a kinetoplastid species with noncatenated, gRNA gene-containing minicircles, which implies that the creation of minicircles and minicircle networks are separate evolutionary events.

Mitochondrial and Nuclear Localization of Topoisomerase II in the Flagellate Bodo saltans (Kinetoplastida), a Species with Non-catenated Kinetoplast DNA

“…Construction and Screening of the Genomic Library-Total DNA of B. saltans was isolated as described elsewhere (14,19). The 1.5-kb-long ATP-binding domain of the topo II gene of B. saltans (BstopoII) was PCR-amplified with degenerate oligonucleotides 12C6 (CATGT(A/ C)CT(C/G)(A/C)T(A/G)(C/A)(G/A)CC(G/A)GAGA(T/C)GTAC) and 12C-7 (CC(A/G)TC(T/G)GC(A/G)TCCTG(A/C)TC(T/G)GTCAT(G/A)A) using the following program: 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min (30 cycles).…”

“…In Situ Hybridization with the Minicircle Probe-The minicircle conserved region of B. saltans (BSM1) was amplified using the primers MB1 (GGGGTACCCCAGCGTTTTTGATGCTGTT) and MB2 (GGAAT-TCCCTCTTTCCCTGGTACT) derived from the available minicircle sequences (14). Biotin labeling of BMS1 (1 unit of Taq polymerase, 5 M each primer, 0.1 mM dATP, dCTP, and dGTP, 0.065 mM dTTP, and 0.35 mM Biotin-N6-dTTP (Renaissance, PerkinElmer Life Sciences)) was carried out under the following conditions: 94°C for 1 min, 55°C for 1.5 min, and 72°C for 2 min (30 cycles) with a final extension of 72°C for 10 min.…”

“…B. saltans is a free-living omnipresent flagellate that represents a significant component of the biological community of the sewage cleaning technologies. As an evolutionary predecessor of parasitic trypanosomatids (14,16,17), it qualifies as an important model organism for the studies of RNA editing and kDNA structure (18). Its minicircles encode classical guide RNA genes (14), which serve for editing of the maxicirclelocated genes that have a novel order and editing pattern (19).…”

“…In Cryptobia helicis, these minicircles are supercoiled and non-catenated (13), while they are relaxed and noncatenated in Bodo saltans and Dimastigella spp. (14,15). B. saltans is a free-living omnipresent flagellate that represents a significant component of the biological community of the sewage cleaning technologies.…”

“…Localization of the kDNA Minicircles-We have PCR-amplified and biotin-labeled a 350-bp-long region that is highly conserved in the B. saltans minicircles (14) and used it as a probe for in situ hybridization. As shown in Fig.…”