Mitochondrial COI-NC-COII sequences in talitrid amphipods (Crustacea)

Abstract

Mitochondrial (mt) sequences from cytochrome oxidase subunit I to the subunit II gene (COI, COII) were analysed in crustacean talitrid amphipods. Species of the genera Orchestia, Talitrus and Talorchestia from the MediterraneanEast Atlantic area were examined. The expected tRNALeu-UUR gene was not revealed between COI and COII. Instead, a short (35-48 bp) noncoding (NC) AT-rich (ca. 90%) region with putative stem loops was found. Here, we discuss briefly the NC region and explore its potential involvement in generating this novel rearrangement. The COI-NC-COII organization, as well as preliminary phylogenetic results, based on both COI-COII nucleotide and amino-acid sequence indicate monophyly of these talitrid taxa. Heredity (2005) 94, 81-86.

Cryptorchestia ruffoi sp. n. from the island of Rhodes (Greece), revealed by morphological and phylogenetic analysis (Crustacea, Amphipoda, Talitridae)

“…n. in relation to other Cryptorchestia species of the Mediterranean and North East Atlantic areas. DNA sequences from the mt region between the COI and COII genes were also analysed; all the species analysed here showed the peculiar rearrangement (data not shown), originally reported in Davolos and Maclean (2005). The phylogenetic scenario based on a Maximum Likelihood method suggested major diversification events, with evolutionary relationships between species generally well supported (Fig.…”

“…400 base pairs (bp) was amplified from the gene encoding the mt COI (some of our samples were old museum specimens in which mitochondrial DNA was degraded and consequently produced only short DNA sequences). The PCR-mediated reaction was performed using the primers BI-COI and SUBIR cited in Davolos and Maclean (2005). The PCR amplification conditions were 2 min at 95 °C, followed by 35 cycles, each consisting of 10–15s at 95 °C, 15s at 48–50 °C and 10s at 72 °C; the final PCR extension step lasted 10 min at 72 °C.…”

On the molecular and morphological evolution of continental and insular Cryptorchestia species, with an additional description of C. garbinii (Talitridae)

“…400 base pairs (bp) was amplified from the gene encoding the mt COI (Davolos et al 2017). The PCR-mediated reaction was performed using the primers BI-COI and SUBIR cited in Davolos and Maclean (2005). The PCR amplification conditions were cited in Davolos et al (2017).…”

Under the volcano: phylogeography and evolution of the cave-dwelling Palmorchestia hypogaea(Amphipoda, Crustacea) at La Palma (Canary Islands)

“…DNA was extracted using Qiagen DNAeasy Tissue kit (Qiagen); in most cases voucher specimens were preserved for morphological analysis. A mitochondrial fragment of about 800 bp including the 3' end of the cox1 sequence, the 5' of cox2 and the intergenic spacer between the two (as the tRNALeu nucleotide sequence (UUR) seems to be absent in the region in these species [ 43 ]) was amplified using primers SUBIF 5'AAGAGGCATACCTCGACGATACTC3' and COII-CROZ 5'CCACAAATTTCTGAACATTGACC3' primers [ 43 , 44 ]. Polymerase chain reaction (PCR) conditions were as follows: 4 min at 95°C followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 1 min and extension at 72°C for 2 min, with a final single extra extension step at 72°C for 10 min.…”