Microchimeric Cells From the Peripheral Blood Associated With Cardiac Grafts Are Bone Marrow Derived, Long-Lived and Maintain Acquired Tolerance to Minor Histocompatibility Antigen H-Y 1

Yano, Yoshikazu; Hara, Masaki; Miyahara, Takeo; Shibata, Koichiro; Onitsuka, Toshio; Nawa, Y; Li, Xiaokang; Suzuki, Seiichi; Amemiya, Hiroshi; Kimura, Hiroyuki

doi:10.1097/00007890-200105270-00017

Cited by 8 publications

(5 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To assess the sensitivity of this assay, titrated numbers of H8 splenocytes were mixed with fixed numbers of B6 splenocytes for extraction of DNA and PCR analysis. Approximately 1 H8 cell in 3.3 × 10 4 B6 splenocytes (0.003%) was reliably detected by this method ( Figure 1B), matching the sensitivity of similar protocols applied in clinical and experimental transplantation medicine (11,30). By this method, H8 donor cells remained detectable for more than 700 days after grafting ( Figure 1C and data not shown).…”

Section: Introductionsupporting

confidence: 72%

Microchimerism maintains deletion of the donor cell-specific CD8+ T cell repertoire

Bonilla

Geuking²,

Aichele³

et al. 2005

Journal of Clinical Investigation

View full text Add to dashboard Cite

Rare cases of stable allograft acceptance after discontinuation of immunosuppression are often accompanied by macrochimerism (> 1% donor cells in blood) or microchimerism (< 1% donor cells in blood). Here, we have investigated whether persistence of donor cells is the cause or the consequence of long-lasting CTL unresponsiveness. We found that engraftment of splenocytes bearing a single foreign MHC class I-restricted epitope resulted in lifelong donor cell microchimerism and specific CTL unresponsiveness. This status was reversed in a strictly time-and thymus-dependent fashion when the engrafted cells were experimentally removed. The results presented herein show that microchimerism actively maintains CTL unresponsiveness toward a minor histocompatibility antigen by deleting the specific repertoire and thus excluding dominant, T cell extrinsic mechanisms of CTL unresponsiveness independent of systemically persisting donor cell antigen.

show abstract

Section: Introductionsupporting

confidence: 72%

Microchimerism maintains deletion of the donor cell-specific CD8+ T cell repertoire

Bonilla

Geuking²,

Aichele³

et al. 2005

Journal of Clinical Investigation

View full text Add to dashboard Cite

show abstract

“…12 Hematopoietic donor microchimerism (donor cells Ͻ 1%) was continuously monitored in all of the 4 female patients with available male donors by detection of the sex-determining region of the Y chromosome with a real-time quantitative PCR protocol with a sensitivity of 10 Ϫ7 as previously described. 20 …”

Section: Detection Of Donor Chimerism and Microchimerismmentioning

confidence: 99%

Infusion of HLA-mismatched peripheral blood stem cells improves the outcome of chemotherapy for acute myeloid leukemia in elderly patients

Guo

et al. 2011

Blood

109

View full text Add to dashboard Cite

Treatment outcome of acute myeloid leukemia (AML) in elderly patients remains unsatisfactory. It has been shown that the infusion of granulocyte colony-stimulating factor-mobilized donor peripheral blood stem cells (G-PBSCs) can enhance graftversus-leukemia effects and speed hematopoietic recovery. Fifty-eight AML patients aged 60-88 years were randomly assigned to receive induction chemotherapy with cytarabine and mitoxantrone (control group; n ‫؍‬ 28) or it plus human leukocyte antigen-mismatched G-PBSCs

show abstract

“…PCR reaction mixture was prepared using SYBR green PCR master mix (Perkin Elmer, Foster City, CA) using the primers of AAGTCAAGCGCCCCATGA (sense) and TGAGCCAACTTGTGCCTCTCT (antisense). 26,27 The reactions were performed using an ABI7000 Prism Sequence Detection System (Perkin Elmer). The thermal cycler was configured as the following: incubation (95°C, 10 minutes), 40 cycles of denaturation (95°C, 15 seconds), and annealing and extension (60°C, 60 seconds).…”

Section: Real-time Pcrmentioning

confidence: 99%

Simultaneous bone marrow and intestine transplantation promotes marrow-derived hematopoietic stem cell engraftment and chimerism

Nakao

Toyokawa

Kimizuka

et al. 2006

Blood

View full text Add to dashboard Cite

Organ allografts have been shown to provide a syngeneic microenvironment for organ-based donor hematopoietic stem cells to maintain long-lasting chimerism after transplantation. We hypothesized that organ allografts would also support engraftment and hematopoiesis of adjunctively infused donor marrow stem cells, syngeneic to organ grafts, in nonmyeloablated recipients. In BN-to-LEW and GFPto-ACI rat combinations, donor bone marrow (BM) infusion together with small intestine transplantation (SITx) under short-course tacrolimus immunosuppression resulted in persistent macrochimerism (more than 5%) for 150 days. In contrast, after BM infusion or SITx alone, chimerism was temporary and disappeared by day 100. Y-chromosome polymerase chain reaction (PCR) in sexmismatched male BM plus female intestine or female BM plus male intestine transplantation into female recipients suggested that persistent macrochimerism was derived from infused BM. BM infusion together with lymphoid-depleted intestine grafts also supported macrochimerism development; however, thirdparty intestine grafts did not.

show abstract

Microchimeric Cells From the Peripheral Blood Associated With Cardiac Grafts Are Bone Marrow Derived, Long-Lived and Maintain Acquired Tolerance to Minor Histocompatibility Antigen H-Y 1

Abstract: Thus it was suggested that radiation-sensitive, bone marrow derived, long-lived MCPB play a significant role in maintaining acquired transplantation tolerance to minor histocompatibility antigen H-Y.

Cited by 8 publications

References 23 publications

Microchimerism maintains deletion of the donor cell-specific CD8+ T cell repertoire

Microchimerism maintains deletion of the donor cell-specific CD8+ T cell repertoire

Infusion of HLA-mismatched peripheral blood stem cells improves the outcome of chemotherapy for acute myeloid leukemia in elderly patients

Simultaneous bone marrow and intestine transplantation promotes marrow-derived hematopoietic stem cell engraftment and chimerism

Contact Info

Product

Resources

About