Metformin inhibits aldosterone-induced cardiac fibroblast activation, migration and proliferation in vitro, and reverses aldosterone+salt-induced cardiac fibrosis in vivo

Mummidi, Srinivas; Das, Nitin A.; Carpenter, Andrea J.; Kandikattu, Hemanth Kumar; Krenz, Maike; Siebenlist, Ulrich; Valente, Anthony J.; Chandrasekar, Bysani

doi:10.1016/j.yjmcc.2016.07.006

Cited by 60 publications

(61 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Water was provided ad libitum. Three month-old wild type C57Bl/6 J mice were used for isolation of cardiac fibroblasts (CF) as previously described [28]. …”

Section: Methodsmentioning

confidence: 99%

“…CF were treated with aldosterone (Aldo; 0.1 μM) for indicated periods as previously described [28, 32]. MR was targeted by spironolactone (5 μM for 15 min) or silenced using lentiviral shRNA (CCGGCCAAGGTACTTCCAGGAT TTACTCGAGTAAATCCTGGAAGTACCTTGGTTTTT, Sigma-Aldrich; multiplicity of infection: 0.5 for 48 h).…”

Section: Methodsmentioning

confidence: 99%

“…We have chosen Aldo because myocardial MR activation was shown to be an important contributor to WD-induced oxidative stress, inflammation, cardiac fibrosis and DD [22, 23]. Hydrogen peroxide generation was quantified by Amplex Red assay [28]. TRAF3IP2 expression was targeted by lentiviral shRNA (CCGGAGAACCATTCCCGAGTCAATTC TCGAGAATTGACTCGGGAATGGTTCTTTTTTG, Sigma-Aldrich; moi 0.5 for 48 h) [28].…”

Section: Methodsmentioning

confidence: 99%

“…Hydrogen peroxide generation was quantified by Amplex Red assay [28]. TRAF3IP2 expression was targeted by lentiviral shRNA (CCGGAGAACCATTCCCGAGTCAATTC TCGAGAATTGACTCGGGAATGGTTCTTTTTTG, Sigma-Aldrich; moi 0.5 for 48 h) [28]. shRNA against eGFP served as a control.…”

Section: Methodsmentioning

confidence: 99%

“…Alpha-smooth muscle actin (α-SMA; #F3777, Fitzgerald Industries International, 2 μg/ml) and vimentin (#sc-373717, Santa Cruz Biotechnology, Inc.; 1 μg/ml) served as markers of CF activation, and were evaluated by western blotting. CF migration was analyzed by BioCoat Matrigel migration assay [28]. CF were treated with linagliptin (30 nM for 1 h) prior to the addition of Aldo.…”

Section: Methodsmentioning

confidence: 99%

See 4 more Smart Citations

Dipeptidyl peptidase-4 (DPP-4) inhibition with linagliptin reduces western diet-induced myocardial TRAF3IP2 expression, inflammation and fibrosis in female mice

Aroor

Habibi

Kandikattu

et al. 2017

Cardiovasc Diabetol

Self Cite

View full text Add to dashboard Cite

BackgroundDiastolic dysfunction (DD), a hallmark of obesity and primary defect in heart failure with preserved ejection fraction, is a predictor of future cardiovascular events. We previously reported that linagliptin, a dipeptidyl peptidase-4 inhibitor, improved DD in Zucker Obese rats, a genetic model of obesity and hypertension. Here we investigated the cardioprotective effects of linagliptin on development of DD in western diet (WD)-fed mice, a clinically relevant model of overnutrition and activation of the renin-angiotensin-aldosterone system.MethodsFemale C56Bl/6 J mice were fed an obesogenic WD high in fat and simple sugars, and supplemented or not with linagliptin for 16 weeks.ResultsWD induced oxidative stress, inflammation, upregulation of Angiotensin II type 1 receptor and mineralocorticoid receptor (MR) expression, interstitial fibrosis, ultrastructural abnormalities and DD. Linagliptin inhibited cardiac DPP-4 activity and prevented molecular impairments and associated functional and structural abnormalities. Further, WD upregulated the expression of TRAF3IP2, a cytoplasmic adapter molecule and a regulator of multiple inflammatory mediators. Linagliptin inhibited its expression, activation of its downstream signaling intermediates NF-κB, AP-1 and p38-MAPK, and induction of multiple inflammatory mediators and growth factors that are known to contribute to development and progression of hypertrophy, fibrosis and contractile dysfunction. Linagliptin also inhibited WD-induced collagens I and III expression. Supporting these in vivo observations, linagliptin inhibited aldosterone-mediated MR-dependent oxidative stress, upregulation of TRAF3IP2, proinflammatory cytokine, and growth factor expression, and collagen induction in cultured primary cardiac fibroblasts. More importantly, linagliptin inhibited aldosterone-induced fibroblast activation and migration.ConclusionsTogether, these in vivo and in vitro results suggest that inhibition of DPP-4 activity by linagliptin reverses WD-induced DD, possibly by targeting TRAF3IP2 expression and its downstream inflammatory signaling.

show abstract

“…Water was provided ad libitum. Three month-old wild type C57Bl/6 J mice were used for isolation of cardiac fibroblasts (CF) as previously described [28]. …”

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Dipeptidyl peptidase-4 (DPP-4) inhibition with linagliptin reduces western diet-induced myocardial TRAF3IP2 expression, inflammation and fibrosis in female mice

Aroor

Habibi

Kandikattu

et al. 2017

Cardiovasc Diabetol

Self Cite

View full text Add to dashboard Cite

show abstract

Endothelial NADPH oxidase 4 protects against angiotensin II‐induced cardiac fibrosis and inflammation

et al. 2021

View full text Add to dashboard Cite

Aims Endothelial activation and inflammatory cell infiltration have important roles in the development of cardiac fibrosis induced by renin-angiotensin system activation. NADPH oxidases (Nox proteins) are expressed in endothelial cells (ECs) and alter their function. Previous studies indicated that Nox2 in ECs contributes to angiotensin II (AngII)-induced cardiac fibrosis. However, the effects of EC Nox4 on cardiac fibrosis are unknown. Methods and results Transgenic (TG) mice overexpressing endothelial-restricted Nox4 were studied alongside wild-type (WT) littermates as controls. At baseline, Nox4 TG mice had significantly enlarged hearts compared with WT, with elongated cardiomyocytes (increased by 18.5%, P < 0.01) and eccentric hypertrophy but well-preserved cardiac function by echocardiography and in vivo pressure-volume analysis. Animals were subjected to a chronic AngII infusion (AngII, 1.1 mg/kg/day) for 14 days. Whereas WT/AngII developed a 2.1-fold increase in interstitial cardiac fibrosis as compared with WT/saline controls (P < 0.01), TG/AngII mice developed significant less fibrosis (1.4-fold increase, P > 0.05), but there were no differences in cardiac hypertrophy or contractile function between the two groups. TG hearts displayed significantly decreased inflammatory cell infiltration with reduced levels of vascular cell adhesion molecule 1 in both the vasculature and myocardium compared with WT after AngII treatment. TG microvascular ECs stimulated with AngII in vitro supported significantly less leukocyte adhesion than WT ECs. Conclusions A chronic increase in endothelial Nox4 stimulates physiological cardiac hypertrophy and protects against AngII-induced cardiac fibrosis by inhibiting EC activation and the recruitment of inflammatory cells. Highlights • Mice with endothelium-specific overexpression of Nox4 (EndoNox4 TG) exhibit eccentric hypertrophy with well-preserved cardiac function at baseline. • EndoNox4 TG mice develop significantly less interstitial cardiac fibrosis in response to chronic pressure AngII stimulation, independent of cardiac hypertrophy. • Overexpression of Nox4 in endothelial cells reduces AngII-induced endothelial activation. • An increase in endothelial Nox4 inhibits AngII-induced recruitment of inflammatory cells in the heart.

show abstract

Chlorogenic Acid Alleviates Hyperglycemia‐Induced Cardiac Fibrosis through Activation of the NO/cGMP/PKG Pathway in Cardiac Fibroblasts

Qin

Zang

et al. 2020

Molecular Nutrition Food Res

View full text Add to dashboard Cite

Scope Hyperglycemia‐induced cardiac fibrosis is one of the main causes of diabetic cardiomyopathy (DM). Chlorogenic acid (CGA) found in many foods has excellent hypoglycemic effectiveness, but it is not known whether CGA can improve DM by inhibiting cardiac fibrosis caused by hyperglycemia. Methods and Results Type I diabetic mice are induced by streptozotocin, and after treatment with CGA for 12 weeks, cardiac functions and fibrosis are determined. CGA significantly attenuates hyperglycemia‐induced cardiac fibrosis and improves cardiac functions. The mechanism of CGA on fibrotic inhibition is further studied by immunofluorescence, western blot and RNA interference technology in vivo and in vitro. The results show CGA exerted its anti‐fibrotic effects through activating the cyclic GMP/protein kinase G pathway (cGMP/PKG) to block hyperglycemia‐induced nuclear translocation of p‐Smad2/3, and then inhibiting pro‐fibrotic gene expression in cardiac fibroblasts without depending on its hypoglycemic function. Moreover, the data also revealed that CGA increased cGMP level and activated PKG in cardiac fibroblasts by enhancing endothelial nitric oxide synthase (eNOS) activity and NO production. Conclusion Besides lowering blood glucose, CGA also has an independent ability to inhibit cardiac fibrosis. Therefore, long‐term consumption of foods rich in CGA for diabetic patients will have great benefits to improve diabetic cardiomyopathy.

show abstract

Metformin inhibits aldosterone-induced cardiac fibroblast activation, migration and proliferation in vitro, and reverses aldosterone+salt-induced cardiac fibrosis in vivo

Cited by 60 publications

References 37 publications

Dipeptidyl peptidase-4 (DPP-4) inhibition with linagliptin reduces western diet-induced myocardial TRAF3IP2 expression, inflammation and fibrosis in female mice

Dipeptidyl peptidase-4 (DPP-4) inhibition with linagliptin reduces western diet-induced myocardial TRAF3IP2 expression, inflammation and fibrosis in female mice

Endothelial NADPH oxidase 4 protects against angiotensin II‐induced cardiac fibrosis and inflammation

Chlorogenic Acid Alleviates Hyperglycemia‐Induced Cardiac Fibrosis through Activation of the NO/cGMP/PKG Pathway in Cardiac Fibroblasts

Contact Info

Product

Resources

About