Mechanisms of stable lipid loss in a social insect

Abstract

SUMMARYWorker honey bees undergo a socially regulated, highly stable lipid loss as part of their behavioral maturation. We used largescale transcriptomic and proteomic experiments, physiological experiments and RNA interference to explore the mechanistic basis for this lipid loss. Lipid loss was associated with thousands of gene expression changes in abdominal fat bodies. Many of these genes were also regulated in young bees by nutrition during an initial period of lipid gain. Surprisingly, in older bees, which is when maximum lipid loss occurs, diet played less of a role in regulating fat body gene expression for components of evolutionarily conserved nutrition-related endocrine systems involving insulin and juvenile hormone signaling. By contrast, fat body gene expression in older bees was regulated more strongly by evolutionarily novel regulatory factors, queen mandibular pheromone (a honey bee-specific social signal) and vitellogenin (a conserved yolk protein that has evolved novel, maturationrelated functions in the bee), independent of nutrition. These results demonstrate that conserved molecular pathways can be manipulated to achieve stable lipid loss through evolutionarily novel regulatory processes. Supplementary material available online at

RNA interference knockdown of DNA methyl-transferase 3 affects gene alternative splicing in the honey bee

“…Comparing our results to previous gene expression studies of fat body, our DEG list also was enriched for genes related to honey bee behavioral maturation, which involves a shift from working in the hive when young to foraging when older (29). We compared our DEG list with DEG lists from fat tissue associated with (i) hive vs. forager bees; (ii) exposure to poor vs. rich diet Examples are shown in detail in Fig.…”

Transcriptional signatures of parasitization and markers of colony decline in Varroa-infested honey bees (Apis mellifera)

“…To test if the gene expression pattern observed in bees from high-infested colonies is consistent with the hypothesized accelerated behavioural maturation caused by mite infestation, we compared our DEG lists with a list of genes that are typically differentially expressed between nurses and foragers (Ament et al, 2011). As highlighted in Fig.…”

“…Furthermore, the downregulation of a fatty acid amide hydrolase (GB8850) and the upregulation of acyl-CoA Delta desaturase like (GB40659) were observed in infested bees. Lipid metabolism is involved in behavioural maturation (Toth and Robinson, 2005); old bees show an increase of lipid loss during the shift from nurses to foragers (Ament et al, 2011) according to a different resources demand.…”

“…6. a Comparisons between high and low infested colony DEG overlaps with forager and nurse genes (Ament et al, 2011). b Comparisons between infested and uninfested newly emerged bee DEG overlaps with forager genes and nurse genes.…”

Parasitic and immune-modulation of flight activity in honey bees tracked with optical counters

“…Cycle threshold (C t ) values of selected genes were normalized to two housekeeping genes Actin and eIF3-S8. Primer sequences (5′-3′) were: JH esterase: forward: TTCTTTCTTCTCTTGTGACTTTTGGTT, reverse: CCCTTAATTGCA -CCTAAAGGAGTTT (Ament et al, 2011); JH epoxide hydrolase forward: TTAACAAAACCTTGGCCTAATCAAA, reverse: GGAGAAACCGTA -TCCAGGAAGTG (Ament et al, 2011); Vitellogenin forward: TTGA -CCAAGACAAGCGGAACT, reverse: AAGGTTCGAATTAACGATGAA (Fischer and Grozinger, 2008); Actin forward: TGCCAACACTGTCC -TTTCTG, reverse: AGAATTGACCCACCAATCCA; and eIF3-S8 forward: TGAGTGTCTGCTATGGATTGCAA, reverse: TCGCGGCTCGTGGT -AAA .…”