Maternal nutritional history modulates the hepatic IGF–IGFBP axis in adult male rat offspring

Abstract

Alterations in early life nutrition lead to an increased risk of obesity and metabolic syndrome in offspring. We have shown that both relative maternal undernutrition (UN) and maternal obesity result in metabolic derangements in offspring, independent of the postnatal dietary environment. Since insulin-like growth factor binding protein 2 (IGFBP2) has been shown to be independently associated with obesity and diabetes risk, we examined the IGF-IGFBP axis in male rat offspring following either maternal UN or maternal obesity to explain possible common pathways in the development of metabolic disorders. Wistar rats were time-mated and fed either a control diet (CONT), 50 % of CONT (UN) or a high-fat (HF) diet throughout pregnancy. Male offspring were weaned onto a standard chow diet and blood and tissues were collected at postnatal day 160. Plasma and hepatic tissue samples were analysed for key players in the IGF-IGFBP system. Both maternal UN and HF resulted in increased fat mass, hyperinsulinemia, hyperleptinemia and altered blood lipid profiles in offspring compared to CONT. Circulating IGF-1 and IGFBP3 levels and hepatic mRNA expression of IGFBP1 and IGFBP2 were significantly decreased in UN and HF offspring compared to CONT. DNA methylation of the IGFBP2 promotor region was similar between maternal dietary groups. Although chaperone gene heat-shock protein 90 and hepatic IGFBP1 were significantly correlated in CONT offspring this effect was absent in both UN and HF offspring. In conclusion, this study is one of the first to directly compare two experimental models of developmental programming representing both ends of the maternal dietary spectrum. Our data suggest that two disparate nutritional models that elicit similar adverse metabolic phenotypes in offspring are characterised by common alterations in the IGF-IGFBP pathway.

Dietary Chromium Restriction of Pregnant Mice Changes the Methylation Status of Hepatic Genes Involved with Insulin Signaling in Adult Male Offspring

“…Several studies have found that, although serum insulin does not increase, HOMA-IR increases in offspring from protein-restricted dams at 3 weeks [29] and 3 months [32]. A maternal diet with 50% of the typical digestible energy results in hyperinsulinemia in offspring at postnatal day 160 [33]. From our results, maternal chromium restriction increased body weight, impaired glucose tolerance, and led insulin resistance.…”

The Association between High Fat Diet around Gestation and Metabolic Syndrome-related Phenotypes in Rats: A Systematic Review and Meta-Analysis

“…44 c,d WM, Flard140YAFAT, LEP, GLU, INSHowie G.J. 73 a,b WMlard42, 140YABWSmith T. 74 WMlard42YAFAT, BW, LEP, GLU, INS, HDLPereira T.J. 75 a SDMlard84YAFAT, LEP, GLU, INSPereira T.J. 75 b SDFlard84YAFAT, GLU, INSCordero P. 76 a,b WM, Flard42YAFAT, BWSloboda D.M. 77 a,b WFlard42, 140PPPBWTsoulis M.W.…”

Maternal undernutrition during pregnancy and lactation affects testicular morphology, the stages of spermatogenic cycle, and the testicular IGF-I system in adult offspring

“…Primer sets were ß-actin forward primer CACCAACTGGGACGATATGGA and ß-actin reverse primer CAGCCTGGATGGCTACGTACAT, 188bp, accession number NM_031144 and IGF1R (commercial purchased Qiagen assay Rn_Igf1r_1_SG; catalogue # QT00178416). 13 Optimal primer conditions were adjusted to cycling conditions: length 20 bp (range 17-23 bp); Tm 63°C (range 60-65°C); and amplicon length 100-300 bp. Dissociation analyses were performed to ensure specificity, and samples producing a single peak in the dissociation curves were used.…”

“…The GH-IGF axis is altered by changes in nutrition with undernutrition elevating circulating concentrations of GH but reducing the concentrations of IGF-I. 12,13 In addition, IGF-I concentrations are reduced following early-life treatment with betamethasone, typically used in management of premature birth. 14 IGF-I is a 70-amino acid peptide that is coded by the Igf1gene.…”