Marker‐fusion PCR for one‐step mutagenesis of essential genes in yeast

Kitazono, Ana; Tobe, Brian T. D.; Kalton, Helen M.; Diamant, Noam; Kron, Stephen J.

doi:10.1002/yea.806

Cited by 23 publications

(22 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A thermostable kanamycin resistance gene, HTK, was also amplified by PCR from pUC18/HTK plasmid DNA (30). The three DNA fragments were fused by the fusion PCR method (31) to obtain the pT7Blue/ttmutS2::HTK plasmid for ttmutS2 gene disruption. pT7Blue/ndx8::Hyg (hygromycin resistance gene) was a generous gift from Drs.…”

Section: Methodsmentioning

confidence: 99%

Crystal Structure of MutS2 Endonuclease Domain and the Mechanism of Homologous Recombination Suppression

Fukui

Nakagawa

Kitamura

et al. 2008

Journal of Biological Chemistry

View full text Add to dashboard Cite

DNA recombination events need to be strictly regulated, because an increase in the recombinational frequency causes unfavorable alteration of genetic information. Recent studies revealed the existence of a novel anti-recombination enzyme, MutS2. However, the mechanism by which MutS2 inhibits homologous recombination has been unknown. Previously, we found that Thermus thermophilus MutS2 (ttMutS2) harbors an endonuclease activity and that this activity is confined to the C-terminal domain, whose amino acid sequence is widely conserved in a variety of proteins with unknown function from almost all organisms ranging from bacteria to man. In this study, we determined the crystal structure of the ttMutS2 endonuclease domain at 1.7-Å resolution, which resembles the structure of the DNase I-like catalytic domain of Escherichia coli RNase E, a sequence-nonspecific endonuclease. The N-terminal domain of ttMutS2, however, recognized branched DNA structures, including the Holliday junction and D-loop structure, a primary intermediate in homologous recombination. The full-length of ttMutS2 digested the branched DNA structures at the junction. These results indicate that ttMutS2 suppresses homologous recombination through a novel mechanism involving resolution of early intermediates.Homologous recombination is required for a variety of DNA transactions such as DNA repair, the rescue of stalled replication forks, and the creation of genetic diversity (1-4). The reaction begins with the introduction of a double strand break in the homologous region of the donor strand (5-7). The ends of the strand are resected by exonucleases to generate termini with 3Ј-overhangs. Then, RecA protein (Rad51 in eukaryotes) recognizes the single-stranded region of the DNA and catalyzes the invasion into the target double-stranded DNA to generate the D-loop structure. The sequential DNA synthesis and ligation yield a general intermediate called the Holliday junction. Several junction-specific endonucleases resolve the junction, and DNA ligase reseals the nicks to complete the process of homologous recombination. This homologous recombination process is utilized not only for the recovery but also for the alteration of genetic information.To avoid unfavorable alteration of genetic information, organisms are equipped with a series of enzymes that not only promote but also suppress homologous recombination (4). Recent studies have shown that bacterial and plant MutS2 proteins are candidate anti-recombination enzymes (8, 9). MutS2 is a paralogue of Escherichia coli MutS, which recognizes a mismatched base pair and induces the mismatch repair (MMR) 2 pathway (Fig. 1). Proteins homologous to E. coli MutS are widely distributed and classified into two subfamilies, MutSI and MutSII, on the basis of amino acid sequence comparison (10). The former is responsible for MMR and includes bacterial MutS and eukaryotic MSH2, MSH3, and MSH6 (11-12). The latter, MutSII, is expected to not be involved in MMR but in recombinational events, and includes bacterial MutS2 a...

show abstract

Section: Methodsmentioning

confidence: 99%

Crystal Structure of MutS2 Endonuclease Domain and the Mechanism of Homologous Recombination Suppression

Fukui

Nakagawa

Kitamura

et al. 2008

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…The URA3 gene was directed to the CAN1 gene by first amplifying CAN1 using the primers bam-CAN1-for (CGGGATCCCAAAAGAAGACGC CGACATAGA) and bam-CAN1-rev (CGGGATCCCTACAA CATTCCAAAATTTGTCCC), cloning into the BamHI site of pRS406, cutting with BglII, and transforming RMY195. Secondly, the ADE2-TG(1-3) cassette was inserted into the NPR2 locus using fusion PCR (Kitazono et al 2002) and the primers 5ЈNPR2 1a (AACTCCACAACAA CACCCTCCAC) and 5ЈNPR2 1b (CGAAGTTTTGATGAGCCACACAGCGGGGCACATCTT CTAATGAGACAC) for the 5Ј end homology with NPR2; 3ЈNPR2 2a (CAGTAACAACGTTGGATCCGACCCCTCAAAA CTCCTCCTTAAATTCCTC) and 3ЈNPR2 2b (AATACCTT CTTCTTCGTCGCTG) for the 3Ј end homology with NPR2; and XhoIpsd158 rev (GGGTCGGATCCAACGTTGTTACTG) for the fusion of the 5Ј NPR2 homology with the ADE2-TG(1-3) from strain UCC5913. The process for creating RMY232 was the same as for RMY231 except UCC5913 was the parent strain.…”

Section: Yeast Strains and Plasmidsmentioning

confidence: 99%

A telomeric repeat sequence adjacent to a DNA double-stranded break produces an anticheckpoint

2005

View full text Add to dashboard Cite

Telomeres are complex structures that serve to protect chromosome ends. Here we provide evidence that in Saccharomyces cerevisiae telomeres may contain an anticheckpoint activity that prevents chromosome ends from signaling cell cycle arrest. We found that an internal tract of telomeric repeats inhibited DNA damage checkpoint signaling from adjacent double-strand breaks (DSBs); cell cycle arrest lasted 8-12 h from a normal DSB, whereas it lasted only 1-2 h from a DSB adjacent to a telomeric repeat. The shortened or abridged arrest was not the result of DNA repair, nor reduced amounts of single-stranded DNA, nor of adaptation. The molecular identity of this telomere repeat-associated anticheckpoint activity is unknown, though it is not dependent upon telomerase or telomere-proximal gene silencing. The anticheckpoint may inhibit the ATR yeast ortholog Mec1 because Rad9 and Rad53 became dephosphorylated and inactivated during the abridged arrest. The anticheckpoint acts regionally; it inhibited signaling from DNA breaks up to 0.6 kb away from the telomeric repeat but not from a DSB present on a separate chromosome. We propose that after formation of the DSB near the telomeric repeat, a mature telomere forms in 1-2 h, and the telomere then contains proteins that inhibit checkpoint signaling from nearby DNA breaks.

show abstract

“…Isolated H2B-mRFP PCR product including a 35S terminator was fused to the indicated AtFH5 promoter regions and 5ЈUTR by marker-fusion PCR (Kitazono et al, 2002) then recombined with Alligator2 (Bensmihen et al, 2004) by Gateway cloning (Invitrogen, Carlsbad, CA, USA). Alligator2 was first digested with HindIII and EcoRV to remove the 2ϫ35S promoter, ATG and 3ϫHA tag.…”

Section: Construction Of Vectorsmentioning

confidence: 99%

Polycomb group-dependent imprinting of the actin regulatorAtFH5regulates morphogenesis inArabidopsis thaliana

2009

View full text Add to dashboard Cite

During embryogenesis, Polycomb group (PcG) complexes deposit silencing histone modifications and target homeotic genes, which regulate the patterning of other transcription factors. This transcriptional network further maintains cell fate. However, genomewide identification of histone modifications has suggested that PcG complexes might regulate genes other than those encoding transcription factors. In Arabidopsis, we show that PcG activity directly targets the actin regulator formin ARABIDOPSIS FORMIN HOMOLOGUE 5 (AtFH5). PcG activity silences the paternal allele of AtFH5, restricting its expression to the maternal allele. AtFH5 thus appears to be a new, maternally expressed imprinted gene. We further demonstrate that AtFH5 is responsible for morphological defects caused by the loss of PcG activity in the seed.

show abstract

Marker‐fusion PCR for one‐step mutagenesis of essential genes in yeast

Cited by 23 publications

References 17 publications

Crystal Structure of MutS2 Endonuclease Domain and the Mechanism of Homologous Recombination Suppression

Crystal Structure of MutS2 Endonuclease Domain and the Mechanism of Homologous Recombination Suppression

A telomeric repeat sequence adjacent to a DNA double-stranded break produces an anticheckpoint

Polycomb group-dependent imprinting of the actin regulatorAtFH5regulates morphogenesis inArabidopsis thaliana

Contact Info

Product

Resources

About