Lymphangiogenesis requires Ang2/Tie/PI3K signaling for VEGFR3 cell-surface expression

Korhonen, Emilia A.; Murtomäki, Aino; Jha, Sawan Kumar; Anisimov, Andrey; Pink, Anne; Zhang, Yan; Stritt, Simon; Liaqat, Inam; Stanczuk, Lukas; Alderfer, Laura; Sun, Zhixin; Kapiainen, Emmi; Singh, Abhishek; Sultan, Ibrahim; Lantta, Anni; Leppänen, Veli-Matti; Eklund, Lauri; He, Yulong; Augustin, Hellmut G.; Vaahtomeri, Kari; Saharinen, Pipsa; Mäkinen, Taija; Alitalo, Kari

doi:10.1172/jci155478

Cited by 46 publications

(42 citation statements)

References 70 publications

(150 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We here show that tie1 mutant zebrafish embryos display severe lymphatic defects in the head and trunk vasculature, in addition to the previously reported cardiac and blood vascular phenotypes including impaired brain angiogenesis, reduced CCV width, and impaired caudal vein plexus formation (Carlantoni et al, 2021). Interestingly, the FCLV, which seem to have a comparable function to collecting lymphatic vessels, is affected in tie1 mutant zebrafish embryos, while Tie1;Tie2 double deletion in mice leads to defective postnatal collecting lymphatic vessel development (Korhonen et al, 2022). Further studies will be required in both mice and fish to determine to what extent Tie signalling affects LEC specification, proliferation, and survival.…”

Section: Discussionsupporting

confidence: 70%

“…Tie1 mutant mice do not show any vascular defects until E13.5 and die from haemorrhages between E13.5 and P0, but display swellings at E12.5 caused by lymphatic malformations that precede the haemorrhaging (D'Amico et al, 2010;Puri et al, 1995;Sato et al, 1995). Additionally, postnatal Tie1 deletion causes impaired lymphatic capillary network development (Korhonen et al, 2022). We here show that tie1 mutant zebrafish embryos display severe lymphatic defects in the head and trunk vasculature, in addition to the previously reported cardiac and blood vascular phenotypes including impaired brain angiogenesis, reduced CCV width, and impaired caudal vein plexus formation (Carlantoni et al, 2021).…”

Section: Discussionmentioning

confidence: 99%

“…Conditional knockout of Tie2 in lymphatic cells revealed the importance of TIE2 for lymphatic vessel development in mice especially for Schlemm's canal formation (Kim et al, 2017;. Recently, Korhonen et al showed that conditional Tie1 deletion, Tie1;Tie2 double deletion and Ang2 blocking resulted in impaired postnatal lymphatic capillary network development in mice (Korhonen et al, 2022). In zebrafish, tie2 mutants do not have any vascular phenotypes (Gjini et al, 2011;Jiang et al, 2020), while tie1 mutants show cardiac morphogenesis and vascular defects (Carlantoni et al, 2021).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

svep1 and tie1 genetically interact and affect aspects of facial lymphatic development in a Vegfc-independent manner

Hußmann¹,

Weischer²,

Carlantoni

et al. 2022

Preprint

View full text Add to dashboard Cite

Multiple factors are required to form functional lymphatic vessels. Here, we uncover an essential role for the secreted protein Svep1 and the transmembrane receptor Tie1 during the development of subpopulations of the zebrafish facial lymphatic network. This specific aspect of the facial network forms independently of Vegfc signalling, which otherwise is the most prominent signalling axis in all other lymphatic beds. Additionally, we find that multiple specific and newly uncovered phenotypic hallmarks of svep1 mutants are also present in tie1, but not in tie2 or vegfc mutants. These phenotypes are observed in the lymphatic vasculature of both head and trunk, as well as in the development of the dorsal longitudinal anastomotic vessel (DLAV) under reduced flow conditions. Furthermore, we show genetic interaction between svep1 and tie1 during the migration of parachordal lymphangioblasts (PLs). Therefore, our study demonstrates an important function for Tie1 signalling during lymphangiogenesis as well as blood vessel development in zebrafish and provides the first in vivo evidence for zebrafish Svep1 and Tie1 interaction. Since compound heterozygous mutations for SVEP1 and TIE2 have recently been reported in human glaucoma patients, our data have clinical relevance in demonstrating a role for Svep1 in Tie signalling in an in vivo setting.

show abstract

Section: Discussionsupporting

confidence: 70%

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

svep1 and tie1 genetically interact and affect aspects of facial lymphatic development in a Vegfc-independent manner

Hußmann¹,

Weischer²,

Carlantoni

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…TIE1 and TIE2 are differentially required during the blood vascular and lymphatic network formation [9, 15, 38]. Recent studies have shown that TIE1 plays important roles in the regulation of blood vascular growth [16-18], in addition to its requirement in the formation of collecting lymphatics [12, 15, 36, 39]. TIE2 is required for the formation and maturation of blood vascular network, especially in vein development [3, 9].…”

Section: Discussionmentioning

confidence: 99%

Endothelial TIE1 restricts angiogenic sprouting to coordinate vein assembly in synergy with its homologue TIE2

Cao

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

Objective: Vascular growth followed by vessel specification is crucial for the establishment of a hierarchical blood vascular network. We have here investigated mechanisms underlying venogenesis, particularly the molecular control over venous fate acquisition during vascular development. Approach and Results: We analyzed the function of TIE1 as well as its synergy with TIE2 in the regulation of vein formation by employing genetic mouse models targeting Tie1 and Tek. Cardinal vein growth appeared normal in TIE1 deficient mice, whereas TIE2 deficiency altered the identity of cardinal vein endothelial cells with the aberrant expression of DLL4. Interestingly, the parallel growth of murine cutaneous veins along with arteries, which was initiated at approximately embryonic day 13.5, was retarded in mice lack of TIE1. Tie1 deletion disrupted also venous integrity, displaying increased sprouting angiogenesis and vascular bleeding. Abnormal venous sprouts with defective arteriovenous alignment were also observed in the mesenteries of Tie1 deleted mice. Mechanistically, TIE1 deficiency resulted in the decreased expression of venous regulators including TIE2 while angiogenic regulators were upregulated. The alteration of TIE2 level by TIE1 insufficiency was further confirmed by the siRNA-mediated knockdown of Tie1 in cultured endothelial cells. Additionally, combining the endothelial deletion of Tie1 with one null allele of Tek resulted in a progressive increase of vein-associated angiogenesis leading to the formation of vascular tufts in retinas, whereas the loss of Tie1 alone produced only a relatively mild venous defect. Conclusions: Findings from this study imply that TIE1 and TIE2 act in a synergistic manner to restrict sprouting angiogenesis during vein formation.

show abstract

“…Angpt2 deletion mice were generated by CRISPR/Cas9-based genome editing. 33 – 36 The CRISPR guideRNA was designed with a guideRNA tool (Crispr.mit.edu, ACTGAGTCGTCGTAGTCGAG). Based on that analysis, CRISPR RNA (crRNA), trans-activating CRISPR RNA (tracrRNA), and Cas9 protein (Cas9 nuclease) were ordered from Integrated DNA Technologies (Coralville, IA, USA).…”

Section: Methodsmentioning

confidence: 99%

Cooperation of Angiopoietin-2 and Angiopoietin-4 in Schlemm's Canal Maintenance

Kapiainen

Elamaa

Miinalainen

et al. 2022

Invest. Ophthalmol. Vis. Sci.

Self Cite

View full text Add to dashboard Cite

Purpose Defects in the iridocorneal angle tissues, including the trabecular meshwork (TM) and Schlemm's canal (SC), impair aqueous humor flow and increase the intraocular pressure (IOP), eventually resulting in glaucoma. Activation of endothelial tyrosine kinase receptor Tie2 by angiopoietin-1 (Angpt1) has been demonstrated to be essential for SC formation, but roles of the other two Tie2 ligands, Angpt2 and Angpt4, have been controversial or not yet characterized, respectively. Methods Angpt4 expression was investigated using genetic cell fate mapping and reporter mice. Congenital deletion of Angpt2 and Angpt4 and tamoxifen-inducible deletion of Angpt1 in mice were used to study the effects of Angpt4 deletion alone and in combination with the other angiopoietins. SC morphology was examined with immunofluorescent staining. IOP measurements, electron microscopy, and histologic evaluation were used to study glaucomatous changes. Results Angpt4 was postnatally expressed in the TM. While Angpt4 deletion alone did not affect SC and Angpt4 deletion did not aggravate Angpt1 deletion phenotype, absence of Angpt4 combined with Angpt2 deletion had detrimental effects on SC morphology in adult mice. Consequently, Angpt2 −/− ; Angpt4 −/− mice displayed glaucomatous changes in the eye. Mice with Angpt2 deletion alone showed only moderate SC defects, but Angpt2 was necessary for proper limbal vasculature development. Mechanistically, analysis of Tie2 phosphorylation suggested that Angpt2 and Angpt4 cooperate as agonistic Tie2 ligands in maintaining SC integrity. Conclusions Our results indicated an additive effect of Angpt4 in SC maintenance and Tie2 activation and a spatiotemporally regulated interplay between the angiopoietins in the mouse iridocorneal angle.

show abstract

Lymphangiogenesis requires Ang2/Tie/PI3K signaling for VEGFR3 cell-surface expression

Cited by 46 publications

References 70 publications

svep1 and tie1 genetically interact and affect aspects of facial lymphatic development in a Vegfc-independent manner

svep1 and tie1 genetically interact and affect aspects of facial lymphatic development in a Vegfc-independent manner

Endothelial TIE1 restricts angiogenic sprouting to coordinate vein assembly in synergy with its homologue TIE2

Cooperation of Angiopoietin-2 and Angiopoietin-4 in Schlemm's Canal Maintenance

Contact Info

Product

Resources

About