<p>The role of miR-382-5p in glioma cell proliferation, migration and invasion</p>

Abstract

Background: Dysregulation of a single miRNA can play an essential role in tumor development and progression. Recent studies have shown that miR-382-5p can function as an oncogene or as a tumor suppressor in different types of cancers. However, the role of miR-382-5p in glioma growth and expansion has not been characterized. Methods: Quantitative real time-PCR (qRT-PCR) was used to measure miR-382-5p levels in glioma tissues. The miR-382-5p mimics and inhibitors were employed to upregulate and downregulate miR-382-5p expression respectively in glioma cells. EdU assay was used to assess cell proliferation. Wound healing and Transwell assays were employed to evaluate cell migration and invasion. Western blot was used to measure the changes of epithelial-to-mesenchymal transition (EMT) markers and the potential miR-382-5p target genes. Results: We found that miR-382-5p levels were low in glioma tissues as determined by qRT-PCR. EdU assay showed that upregulation of miR-382-5p significantly decreased cell proliferation in both U87 and U251 cells. Wound healing rate was significantly decreased in response to miR-382-5p mimics and significantly increased in response to miR-382-5p inhibitors. Transwell migration assays further confirmed the inhibitory effects of miR-382-5p on the migration in both U251 and U87 cells. Transwell invasion assays showed that upregulation of miR-382-5p resulted in a remarkable decrease in the number of invading cells, whereas downregulation of miR-382-5p led to a significant increase in the numbers of invading U87 and U251 cells. In addition, overexpression of miR-382-5p decreased the protein levels of N-cadherin, Snail and Slug, and increased E-cadherin levels, in glioma cells. Furthermore, miR-382-5p levels negatively correlated with Y box-binding protein 1 (YBX1) in lower grade glioma tissues, and negatively regulated the expression of YBX1 in glioma cells. Conclusion: In summary, miR-382-5p inhibited proliferation, migration, invasion, and the EMT in glioma cells, possibly through targeting the oncogene YBX1.

LINC00511 contributes to glioblastoma tumorigenesis and epithelial‐mesenchymal transition via LINC00511/miR‐524‐5p/YB1/ZEB1 positive feedback loop

“…37,47 Studies have reported that YB1 can regulate proliferation and metastasis by binding to lncRNAs 37,47 or miRNAs, 48 and even demonstrate that YB1 effects EMT. 37,47 Studies have reported that YB1 can regulate proliferation and metastasis by binding to lncRNAs 37,47 or miRNAs, 48 and even demonstrate that YB1 effects EMT.…”

miR‐647 inhibits glioma cell proliferation, colony formation and invasion by regulating HOXA9

“…Overexpression of miR‐940 inhibits glioma progression both in vitro and in vivo by targeting CKS1 . Furthermore, miR‐382‐5p expression was found to be reduced in glioma tissues, and its overexpression inhibits glioma cell proliferation, migration, invasion and epithelial–mesenchymal transition by targeting Y box‐binding protein 1 …”

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

“…The mature gene locus were chr14:101,054,316-101,054,337, and the base sequence was GAAGUUGUUCGUGGUGGAUUCG , with a length of 22 nt. (Fig.1) 2.1.2 hsa-miR-382-5P participates in disease regulation Using PubMed to retrieve the related literature of miR-382-5P, we found that miR-382-5P was upregulated in acute promyelocytic leukemia [7,8] , atherosclerosis [12] ,breast cancer [4] ,epidural fibrosis [10] , primary myelofibrosis [9] , primary liver cancer [11] ,cervical cancer [13] , but down-regulated in glioma [5,6] ,oral squamous cell carcinoma [3] ,miR-382 was down-regulated in non-small cell lung cancer [14,15] , osteosarcoma [16] , prostate cancer [19] ,ovarian cancer [20] , primary liver cancer [24] , colorectal cancer [21,22] , while schizophrenia [25] ,diabetic nephropathy [17] , IgA nephropathy [18] ,infantile hemangioma [23] . Thus, the expression of miR-382-5P is tissue-specific, and it is involved in the regulation of cell viability, migration, invasion, angiogenesis, proliferation, cell differentiation, oxidative stress and other biological behaviors.…”

“…A series of nucleases obtained mature miR-382-5P and miR-382-3P by cutting and editing miR-382, in which miR-382-5P was located in the long arm of chromosome 14. In recent years, many studies have shown that the expression of miR-382-5P is abnormal in oral squamous cell carcinoma [3] ,breast cancer [4] ,glioma [5,6] ,acute promyelocytic leukemia [7,8] ,primary myelofibrosis [9] ,epidural fibrosis [10] ,primary liver cancer [11] ,atherosclerosis [12] ,cervical cancer [13] ,miR-382 is abnormal in non-small cell lung cancer [14,15] , osteosarcoma [16] , diabetic nephropathy [17] , IgA nephropathy [18] prostate cancer [19] ,ovarian cacner [20] ,colorectal cancer [21,22] ,infantile hemangioma [23] ,primary liver cancer [24] ,schizophrenia [25] , which are closely related to the proliferation, differentiation, migration, invasion, drug resistance and other biological processes of tumor cells. However, the expression and clinical significance of miR-382-5P in ovarian cancer have not been reported.…”