Long-range PCR in next-generation sequencing: comparison of six enzymes and evaluation on the MiSeq sequencer

Abstract

Long-range PCR remains a flexible, fast, efficient and cost-effective choice for sequencing candidate genomic regions in a small number of samples, especially when combined with next-generation sequencing (NGS) platforms. Several long-range DNA polymerases are advertised as being able to amplify up to 15 kb or longer genomic DNA. However, their real-world performance characteristics and their suitability for NGS remain unclear. We evaluated six long-range DNA polymerases (Invitrogen SequalPrep, Invitrogen AccuPrime, TaKaRa PrimeSTAR GXL, TaKaRa LA Taq Hot Start, KAPA Long Range HotStart and QIAGEN LongRange PCR Polymerase) to amplify three amplicons, with sizes of 12.9 kb, 9.7 kb, and 5.8 kb, respectively. Subsequently, we used the PrimeSTAR enzyme to amplify entire BRCA1 (83.2 kb) and BRCA2 (84.2 kb) genes from nine subjects and sequenced them on an Illumina MiSeq sequencer. We found that the TaKaRa PrimeSTAR GXL DNA polymerase can amplify almost all amplicons with different sizes and Tm values under identical PCR conditions. Other enzymes require alteration of PCR conditions to obtain optimal performance. From the MiSeq run, we identified multiple intronic and exonic single-nucleotide variations (SNVs), including one mutation (c.5946delT in BRCA2) in a positive control. Our study provided useful results for sequencing research focused on large genomic regions.

Comparative mitochondrial genomic analyses of three chemosynthetic vesicomyid clams from deep‐sea habitats

“…The PrimeSTAR® GXL DNA Polymerase kit (Takara, Dalian, China) was used to perform the long‐PCR reactions (Jia, Guo, Zhao, & Wang, 2014). The reaction conditions were set as follows: 10 μl 5 × PrimeSTAR GXL Buffer, 4 μl dNTP Mixture (2.5 mmol/L each dNTP), primers 0.2 μmol/L each, 2 μl PrimeSTAR GXL DNA Polymerase, 4 μl template DNA, ddH 2 O up to 50 μl.…”

SeqMule: automated pipeline for analysis of human exome/genome sequencing data

“…Many users have used SeqMule to analyze their sequencing data and obtained meaningful results 47 48 49 . With the rapid development and deployment of next-generation sequencing technologies, we expect that SeqMule will facilitate analysis of the upcoming massive amounts of sequencing data to expedite discoveries for human genetic diseases.…”

A D+ blood donor with a novel RHD*D‐CE(5‐6)‐D gene variant exhibits the low‐frequency antigen RH23 (DW) characteristic of the partial DVa phenotype

“…This LR PCR procedure used D‐specific forward primer D‐3‐383, (5′‐TGTCGGTGCTGATCTCAGTGGA‐3′), located in Exon 3, and D‐specific reverse primer D‐7‐1048 (5′‐TGCCGGCTCCGACGGTATC‐3′), located in Exon 7, to amplify a 16.055‐kb product. TaKaRa PrimeSTAR GXL DNA polymerase (Scientifix Pty Ltd) kit was used for this experiment . A two‐step PCR condition was performed (30 cycles at 98°C for 10 sec followed by 68°C for 10 min) as recommended by the manufacturer.…”

“…TaKaRa PrimeSTAR GXL DNA polymerase (Scientifix Pty Ltd) kit was used for this experiment. 32 A two-step PCR condition was performed (30 cycles at 988C for 10 sec followed by 688C for 10 min) as recommended by the manufacturer. PCR mixes and assay conditions are provided as supporting information (Table S1, available as supporting information in the online version of this paper).…”