Liver‐originated small extracellular vesicles with TM4SF5 target brown adipose tissue for homeostatic glucose clearance

Jung, Jae Woo; Kim, Ji Eon; Kim, Eun‐Mi; Lee, Hye-Jin; Lee, Haesong; Shin, Eun‐Hee; Lee, Sang Eun

doi:10.1002/jev2.12262

Cited by 9 publications

(18 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Jung et al generated hepatic TM4SF5-overexpressing (Alb-Tm4sf5 TG) mice and isolated TM4SF5-loaded exosomes from liver-circulating fluids. The administration of TM4SF5-loaded exosomes to TM4SF5 knockout mice induced the clearance of excess glucose clearance by targeting brown adipose tissues 45 . Several researchers have transfected several plasmids together to increase the therapeutic efficacy.…”

Section: Exosomes For Therapeutic Agent Deliverymentioning

confidence: 99%

Recent advances in extracellular vesicles for therapeutic cargo delivery

Kim,

Park,

Zhu

et al. 2024

Exp Mol Med

View full text Add to dashboard Cite

Exosomes, which are nanosized vesicles secreted by cells, are attracting increasing interest in the field of biomedical research due to their unique properties, including biocompatibility, cargo loading capacity, and deep tissue penetration. They serve as natural signaling agents in intercellular communication, and their inherent ability to carry proteins, lipids, and nucleic acids endows them with remarkable therapeutic potential. Thus, exosomes can be exploited for diverse therapeutic applications, including chemotherapy, gene therapy, and photothermal therapy. Moreover, their capacity for homotypic targeting and self-recognition provides opportunities for personalized medicine. Despite their advantages as novel therapeutic agents, there are several challenges in optimizing cargo loading efficiency and structural stability and in defining exosome origins. Future research should include the development of large-scale, quality-controllable production methods, the refinement of drug loading strategies, and extensive in vivo studies and clinical trials. Despite the unresolved difficulties, the use of exosomes as efficient, stable, and safe therapeutic delivery systems is an interesting area in biomedical research. Therefore, this review describes exosomes and summarizes cutting-edge studies published in high-impact journals that have introduced novel or enhanced therapeutic effects using exosomes as a drug delivery system in the past 2 years. We provide an informative overview of the current state of exosome research, highlighting the unique properties and therapeutic applications of exosomes. We also emphasize challenges and future directions, underscoring the importance of addressing key issues in the field. With this review, we encourage researchers to further develop exosome-based drugs for clinical application, as such drugs may be among the most promising next-generation therapeutics.

show abstract

Section: Exosomes For Therapeutic Agent Deliverymentioning

confidence: 99%

Recent advances in extracellular vesicles for therapeutic cargo delivery

Kim,

Park,

Zhu

et al. 2024

Exp Mol Med

View full text Add to dashboard Cite

show abstract

“…Integrin and tetraspanin proteins, canonical components of EVs, mediate the interaction of the EV with recipient cell membranes ( Figure 1A and Table 1 ). Alpha and beta subunits in the heterodimeric integrin complex determine the specificity for binding to the extracellular matrix ( 45 , 46 ). There are over 18 alpha-subunit variants and eight beta-subunit variants in the integrin family.…”

Section: Understanding Ev Tropism Based On Cellular Source and Releva...mentioning

confidence: 99%

Defining tropism and activity of natural and engineered extracellular vesicles

Choi,

Park,

Eliceiri

2024

Front. Immunol.

View full text Add to dashboard Cite

Extracellular vesicles (EVs) have important roles as mediators of cell-to-cell communication, with physiological functions demonstrated in various in vivo models. Despite advances in our understanding of the biological function of EVs and their potential for use as therapeutics, there are limitations to the clinical approaches for which EVs would be effective. A primary determinant of the biodistribution of EVs is the profile of proteins and other factors on the surface of EVs that define the tropism of EVs in vivo. For example, proteins displayed on the surface of EVs can vary in composition by cell source of the EVs and the microenvironment into which EVs are delivered. In addition, interactions between EVs and recipient cells that determine uptake and endosomal escape in recipient cells affect overall systemic biodistribution. In this review, we discuss the contribution of the EV donor cell and the role of the microenvironment in determining EV tropism and thereby determining the uptake and biological activity of EVs.

show abstract

“…C7BL/6N male mice were purchased from Orient Bio Inc. (Seongnam, Korea) and housed in specific pathogenfree rooms with controlled humidity and temperature. Tm4sf5-knockout C57BL/6N mice (Tm4sf5 −/− ) were generated as described previously [9,18]. The Tm4sf5 exon 1 region (CCACCTGGACGGACGGCAACCTCAGC) was excised using CRISPR RGEN technology.…”

Section: Micementioning

confidence: 99%

“…(1:1,000; #2775), COX4 (1:1,000; #4850), and FLAG (1:2,000; #2368) from Cell Signaling Technology (Danvers, MA, USA). The anti-TM4SF5 antibody (1:5,000) was generated by immunizing rabbits with a TM4SF5 C-terminal or a long extracellular loop 2 sequence peptide [9].…”

Section: Western Blottingmentioning

confidence: 99%

“…TM4SF5 binds to mammalian target of rapamycin (mTOR) at lysosomes, leading to mTOR complex I (mTORC1) and ribosomal protein S6 kinase β‐1 (S6K1) activation via lysosomal arginine sensing and subsequent export into the cytosol [ 5 ]. Furthermore, TM4SF5 in hepatocytes is loaded on exosomes and involved in the metabolic crosstalk between the liver and brown adipose tissue [ 9 ].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Glucose‐mediated mitochondrial reprogramming by cholesterol export at TM4SF5‐enriched mitochondria‐lysosome contact sites

Kim,

Park,

Kwak

et al. 2023

Cancer Communications

Self Cite

View full text Add to dashboard Cite

BackgroundTransmembrane 4 L six family member 5 (TM4SF5) translocates subcellularly and functions metabolically, although it is unclear how intracellular TM4SF5 translocation is linked to metabolic contexts. It is thus of interests to understand how the traffic dynamics of TM4SF5 to subcellular endosomal membranes are correlated to regulatory roles of metabolisms.MethodsHere, we explored the metabolic significance of TM4SF5 localization at mitochondria‐lysosome contact sites (MLCSs), using in vitro cells and in vivo animal systems, via approaches by immunofluorescence, proximity labelling based proteomics analysis, organelle reconstitution etc.ResultsUpon extracellular glucose repletion following depletion, TM4SF5 became enriched at MLCSs via an interaction between mitochondrial FK506‐binding protein 8 (FKBP8) and lysosomal TM4SF5. Proximity labeling showed molecular clustering of phospho‐dynamic‐related protein I (DRP1) and certain mitophagy receptors at TM4SF5‐enriched MLCSs, leading to mitochondrial fission and autophagy. TM4SF5 bound NPC intracellular cholesterol transporter 1 (NPC1) and free cholesterol, and mediated export of lysosomal cholesterol to mitochondria, leading to impaired oxidative phosphorylation but intact tricarboxylic acid (TCA) cycle and β‐oxidation. In mouse models, hepatocyte Tm4sf5 promoted mitophagy and cholesterol transport to mitochondria, both with positive relations to liver malignancy.ConclusionsOur findings suggested that TM4SF5‐enriched MLCSs regulate glucose catabolism by facilitating cholesterol export for mitochondrial reprogramming, presumably while hepatocellular carcinogenesis, recapitulating aspects for hepatocellular carcinoma metabolism with mitochondrial reprogramming to support biomolecule synthesis in addition to glycolytic energetics.

show abstract

Liver‐originated small extracellular vesicles with TM4SF5 target brown adipose tissue for homeostatic glucose clearance

Cited by 9 publications

References 58 publications

Recent advances in extracellular vesicles for therapeutic cargo delivery

Recent advances in extracellular vesicles for therapeutic cargo delivery

Defining tropism and activity of natural and engineered extracellular vesicles

Glucose‐mediated mitochondrial reprogramming by cholesterol export at TM4SF5‐enriched mitochondria‐lysosome contact sites

Contact Info

Product

Resources

About