Laser Microdissection Reveals That Transcripts for Five Plant and One Fungal Phosphate Transporter Genes Are Contemporaneously Present in Arbusculated Cells

Abstract

The establishment of a symbiotic interaction between plant roots and arbuscular mycorrhizal (AM) fungi requires both partners to undergo significant morphological and physiological modifications which eventually lead to reciprocal beneficial effects. Extensive changes in gene expression profiles recently have been described in transcriptomic studies that have analyzed the whole mycorrhizal root. However, because root colonization by AM fungi involves different cell types, a cell-specific gene expression pattern is likely to occur. We have applied the laser microdissection (LMD) technology to investigate expression profiles of both plant and fungal genes in Lycopersicon esculentum roots colonized by Glomus mosseae. A protocol to harvest arbuscule-containing cells from paraffin sections of mycorrhizal roots has been developed using a Leica AS LMD system. RNA of satisfactory quantity and quality has been extracted for molecular analysis. Transcripts for plant phosphate transporters (LePTs), selected as molecular markers for a functional symbiosis, have been detected by reverse-transcriptase polymerase chain reaction assays and associated to distinct cell types, leading to novel insights into the distribution of LePT mRNAs. In fact, the transcripts of the five phosphate transporters (PTs) have been detected contemporaneously in the same arbusculated cell population, unlike from the neighboring noncolonized cells. In addition, fungal H(+)ATPase (GmHA5) and phosphate transporter (GmosPT) mRNAs were found exclusively in arbusculated cells. The discovery that five plant and one fungal PT genes are consistently expressed inside the arbusculated cells provides a new scenario for plant-fungus nutrient exchanges.

Ascorbate oxidase: The unexpected involvement of a ‘wasteful enzyme’ in the symbioses with nitrogen-fixing bacteria and arbuscular mycorrhizal fungi

“…Mycorrhizal and non mycorrhizal roots (dissected into 5-to 10-mm segments with a razor blade in the freshly prepared fixative) were fixed in freshly prepared Methacarn (absolute methanol/chloroform/glacial acetic acid 6:3:1) at 4 °C overnight for paraffin embedding [43]. Leica RNase-free PEN-foil slides were used for LMD.…”

“…The deparaffinized slides were placed face down on the microscope. The tissues were visualized on a computer monitor through a video camera and the selected cells were dissected as described [43]. The dissection conditions were optimized to obtain a clean, narrow excision of the selected cells: 40-XT objective at power 35 to 45 and speed 3 to 4.…”

“…Then, for the following steps of RNA extraction, cells were pooled in a single tube with a final volume of 50 μl. RNA extractions were performed as described in Balestrini et al (2007). RNA quantification was obtained using the NanoDrop 1000 spectrophotometer.…”

“…A One-Step RT-PCR kit (Qiagen, Valencia, CA, U.S.A.) was used for the RT-PCR experiments conducted on the RNA extracted from the several samples. Reactions were carried out following the protocol described in Balestrini et al [43] and amplification reactions were run for 40 cycles. Specific primers for LjAO1 (LjAOXf and LjAOXr) were used in addition to specific primers for LjEF1 (TC14054) as housekeeping gene: LjEF1αF, TGTGAAGGATCTCAAGCGTG and LjEF1αR, GTATGGCAATCAAGGACTGG.…”

Root starch accumulation in response to arbuscular mycorrhizal colonization differs among Lotus japonicus starch mutants

“…Since AM fungi also represent a carbon cost to the plant, it is of utmost importance to characterize and understand the molecular components involved in the mutual exchange of nutrients and their impact on plant physiology and productivity (Sawers et al 2008). While transcriptomics and genetics studies have provided convincing evidence that the AM fungus plays an important role in plant P and N uptake (Balestrini et al 2007;Javot et al 2007;Gomez et al 2009;Guether et al 2009a;Branscheid et al 2010) and indicate how the nutrient status of the plant influences AM development (Javot et al 2007;Yoneyama et al 2007;Nagy et al 2009;Breuillin et al 2010), information on the molecular components important for carbon transfer to the fungus and carbon metabolism in mycorrhizal plants remains rather patchy (Franken 2010). …”