Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway

Rosey, Everett L.; Oskouian, Babak; Stewart, George C.

doi:10.1128/jb.173.19.5992-5998.1991

Cited by 65 publications

(64 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this organism, galactose is phosphorylated during vectorial transport of galactose or lactose by the phosphoenolpyruvate-dependent PTS (13) and is then metabolized via the tagatose 6-phosphate pathway as described for Staphylococcus aureus (5) and later demonstrated for S. mutans (21): D-galactose 6-phosphate -k D-tagatose 6-phosphate --D-tagatose 1,6-bisphosphate --D-glyceraldehyde 3-phosphate plus dihydroxyacetone phosphate. The enzymatic activities effecting the degradation of galactose 6-phosphate are galactose-6-phosphate isomerase (9), tagatose-6-phosphate kinase (7), and tagatose-1,6-bisphosphate aldolase (8).We recently reported the molecular organization of the lacABCD genes encoding these enzymes in S. aureus (35). These genes are part of a heptacistronic operon, lacAB CDFEG, in which the terminal three genes, lacFEG, encode the sugar-specific transport components enzyme IIIlactose (EIIII"c; EIIA'C as proposed elsewhere [37]) and 6159 on May 12, 2018 by guest…”

mentioning

confidence: 99%

“…1B) (36). The latter polypeptide demonstrates tagatose-6-phosphate kinase activity in S. aureus (35). The (Fig.…”

mentioning

confidence: 99%

“…We recently reported the molecular organization of the lacABCD genes encoding these enzymes in S. aureus (35). These genes are part of a heptacistronic operon, lacAB CDFEG, in which the terminal three genes, lacFEG, encode the sugar-specific transport components enzyme IIIlactose (EIIII"c; EIIA'C as proposed elsewhere [37]) and 6159 on May 12, 2018 by guest…”

mentioning

confidence: 99%

“…TTATAAGATTTCAiAQACAAGAAATT1GTATTGCTATTTACATGTGGCTATCAAAC 2820 scribed in this work have been assigned GenBank accession pathway from S. aureus (35) (43) demonstrated that the streptococcal hypothesis, restriction digests of total DNA from S. aureus DNA contained in pYA501 encoded enzymes of the tagatose and S. mutans were tested for hybridization to the S. mu-6-phosphate rather than the Leloir pathway. We have retans insert-containing plasmid pYA501 probe under concently characterized the genes of the tagatose 6-phosphate ditions of low stringency (Fig.…”

mentioning

confidence: 99%

“…Throughout the course of defining the S. aureus tagatose 6-phosphate genes, we were able to partially complement Escherichia coli fda or pjk mutants by using a plasmid, pYA501, which contains a 5-kb chromosomal fragment from S. mutans PS14 (serotype c). This plasmid was previously shown to encode enzymes of the tagatose 6-phosphate pathway (43) and encodes proteins very similar in size to those encoded by the staphylococcal lacABCD genes (24,35,36). Because of the similarities in lactose metabolism between these organisms, we have determined the molecular organization of the genes specified by the S. mutans insert Bacterial strains, media, and reagents.…”

mentioning

confidence: 99%

See 4 more Smart Citations

Nucleotide and deduced amino acid sequences of the lacR, lacABCD, and lacFE genes encoding the repressor, tagatose 6-phosphate gene cluster, and sugar-specific phosphotransferase system components of the lactose operon of Streptococcus mutans

Rosey

Stewart

1992

J Bacteriol

Self Cite

View full text Add to dashboard Cite

The complete nucleotide sequences of lacRABCDF and partial nucleotide sequence of lacE from the lactose operon of Streptococcus mutans are presented. (Mr 11,401), and 123 (NH2-terminal) amino acids, respectively. As inferred from their direct homology to the staphylococcal bc genes, these determinants would encode the repressor of the streptococcal lactose operon (LacR), galactose-6-phosphate isomerase (LacA and LacB), tagatose-6-phosphate kinase (LacC), tagatose-1,6-bisphosphate aldolase (LacD), and the sugar-specific components enzyme M-lactose (LacF) and enzyme U-lactose (LacE) of the S. mutans phosphoenolpyruvate-dependent phosphotransferase system. The nucleotide sequence encompassing the S. mutans lac promoter appears to contain repeat elements analogous to those of S. aureus, suggesting that repression and catabolite repression of the lactose operons may be similar in these organisms.Streptococcus mutans is known to attach to and colonize the tooth pellicle and peridontium of humans, where the utilization of dietary sucrose leads to the formation of dental plaque (20). The fermentative metabolism of these and other oral microorganisms yields lactic acid, which acts directly and indirectly upon the teeth and peridontium, ultimately causing caries and peridontal disease (12). The oral streptococci are also cariogenic in animal models when the diet contains acidogenic carbohydrates other than sucrose. These carbohydrates include lactose and starch, which are major constituents of the human diet, as well as less prevalent carbohydrates such as glucose, fructose, and maltose (18). Since lactose is present in high concentrations in bovine milk and is generally consumed by humans in large quantities throughout life, or at least during the preadolescent or "caries-prone" years, it can be considered a dietary carbohydrate of significant importance in cariogenesis. If the virulence of S. mutans is dependent upon its metabolic potential (12), it appears that a thorough understanding of not only sucrose but also lactose metabolism is essential before effective measures to eliminate dental caries in humans can be designed. Lactose catabolism by several oral streptococcal strains has been shown to proceed via two mechanistically distinct pathways. For some isolates, such as Streptococcus salivarius 25975 (22), the metabolism of lactose appears to proceed mainly by hydrolysis of the disaccharide via P-galactosidase to glucose and galactose (although significant lactose-phosphotransferase system [PTS] activity is induced upon growth on lactose). The latter hexose is then converted to glucose 6-phosphate via the Leloir pathway (29): D-galactose --D-galactose 1-phosphate -* D-glucose 1-phosphate -* D-glucose 6-phosphate. In S. mutans, low or negligible levels of 1-galactosidase activity are detectable (22). In this organism, galactose is phosphorylated during vectorial transport of galactose or lactose by the phosphoenolpyruvate-dependent PTS (13) and is then metabolized via the tagatose 6-phosphate pathway as described f...

show abstract

mentioning

confidence: 99%

“…1B) (36). The latter polypeptide demonstrates tagatose-6-phosphate kinase activity in S. aureus (35). The (Fig.…”

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%