L6 cells as a tissue culture model for thyroid hormone effects on skeletal muscle metabolism.

Koenig, Ronald J.; Smith, Robert J.

doi:10.1172/jci112046

Cited by 27 publications

(14 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The higher expression of the major skeletal muscle receptor T 3 R␤1 at the mRNA and protein levels in L6 myotubes supports a former report of functional T 3 R in L6 myotubes (12). Both cell lines did not react with a significant myotube atrophy after a 3-day treatment, and T 3 receptor analysis excluded receptor deficiency as a cause.…”

Section: Discussionsupporting

confidence: 87%

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes

Sultan¹,

Henkel²,

Terlou³

et al. 2006

American Journal of Physiology-Cell Physiology

View full text Add to dashboard Cite

Myofiber atrophy is the final outcome of muscle wasting induced by catabolic factors such as glucocorticoids and thyroid hormones. We set up an in vitro system to define the catabolic reaction based on myotube atrophy. Both mouse C(2)C(12) and rat L6 cells were used. C(2)C(12) myotube formation was improved by replacing horse serum with the serum substitute Ultroser G. A new method was developed to quantify size changes of large (0.5-1 mm) myotubes only, excluding remaining myoblasts and small myotubes. Dexamethasone reduced myotube size by 30% in L6 but not in C(2)C(12) myotubes. Expression of the glucocorticoid receptor was twofold higher in L6 myotubes than in C(2)C(12) myotubes. In both cell lines, 3,3',5-triiodo-l-thyronine (T(3)) did not induce a significant size reduction. Expression of the major T(3) receptor (T(3)Rbeta1) was higher in L6 myotubes. We investigated whether the changes in myotube size are related to changes in atrogin-1 expression, as this enzyme is thought to be a key factor in the initiation of muscle atrophy. Dexamethasone induced a twofold increase of atrogin-1 mRNA; again, only L6 myotubes were susceptible. Interestingly, atrogin-1 expression in Ultroser G-fused C(2)C(12) myotubes was lower than that in horse serum-fused myotubes. Furthermore, dexamethasone treatment increased atrogin-1 expression only in horse serum-fused myotubes but not in Ultroser G-fused myotubes. Ultroser G-induced fusion may result in atrophy-resistant C(2)C(12) myotubes. Therefore, C(2)C(12) myotubes offer an ideal system in which to study skeletal muscle atrophy because, depending on differentiation conditions, C(2)C(12) cells produce atrophy-inducible and atrophy-resistant myotubes.

show abstract

Section: Discussionsupporting

confidence: 87%

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes

Sultan¹,

Henkel²,

Terlou³

et al. 2006

American Journal of Physiology-Cell Physiology

View full text Add to dashboard Cite

show abstract

“…We propose, therefore, as the simplest interpretation of the results, that positive regulatory factor(s) under the control of thyroid hormone, possibly including the T3 nuclear receptor, interact with upstream DNA control elements to activate transcription of the a-MHC gene. Since L6 cells have been shown to contain functional high-affinity T3 receptors (31) but are unable to regulate transfected MHC/CAT fusion genes in a hormonedependent manner (Fig. 3), additional DNA-binding factors may be required to regulate the a-MHC gene.…”

Section: Discussionmentioning

confidence: 99%

Thyroid hormone regulates expression of a transfected alpha-myosin heavy-chain fusion gene in fetal heart cells.

Gustafson¹,

Markham²,

Bahl³

et al. 1987

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

In ventricular muscle, 3,5,3'-triiodo-L-thyronine (T3) stimulates the expression of the a-myosin heavychain (a-MHC) gene. To test for gene elements required for induction, a fragment of the a-MHC gene containing 2.9 kilobases of 5' flanking sequences and 420 base pairs of DNA 3' to the transcription initiation site was linked to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene. The a-MHC fusion gene was introduced into primary cultures of fetal rat heart myocytes. Induction of the transfected gene was monitored by assaying CAT activity while endogenous a-MHC mRNA expression was measured by using a synthetic oligonucleotide probe complementary to sequences in the 3' untranslated region of the mRNA. Without T3, CAT activity was only slightly greater than background. When T3 at a final concentration of 10 nM was added to the cultures, CAT activity was increased 8-fold by 48 hr. The response time and doses of T3 required for induction of CAT activity and a-MHC mRNA in transfected cells were similar, suggesting that the synthetic and endogenous genes may have a common mechanism of control. When simian virus 40 enhancer and early promoter sequences were included in the construct, CAT activity was constitutively expressed, but it could be increased 7-fold by the addition of T3. Several deletions were introduced into the 5' flanking sequences of the a-MHC fragment and the effects on induction of CAT activity were examined. Progressive deletions of 5' sequences from positions -947 to -374 reduced but did not eliminate induction of CAT activity, suggesting that more than one region may be required for optimal induction by thyroid hormone. The results indicate that DNA sequences required for efficient induction by T3 are present in the 5' flanking sequences of the a-MHC gene.

show abstract

“…Cells were harvested 1 day later. CAT activity was measured in cell extracts by using [14C]chloramphenicol (12) To assess expression of erb62 protein, COS-cell nuclei were isolated (15) 1 day after transfection with 10 Mg of either CACCGGCTGCTCGGCCGCAGCTCGCCCGCGCGCCGCCTCGGGGCCACCGCCAGGCTCCAGCGCTCCGGTTCAAGAGGAGCCACACTGGGGAGTCCCAAGGAAGCAGCCAGGCAGATGGGG AGCCCAGGATCCGTGGTTCCCTCTCCTTAGTCTGCTGGAGGACGCGCGTGGTGGTACCAAGTTCCACACATGACTTAATGAATAGGGAATGCCAGAGCTGAAGAG;GACCCAGCATGAC TACTAACCTATGACTCCTAACAGTATGACAGAAAATGCCTTCCAGCCTGGGACAACAGAAGCCCCATCCAGACCGAGGCCAGGACTGGAAGCTGGTAGGAATGTCCGAAGCCTGCCTG (15).…”

mentioning

confidence: 99%

Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor.

Koenig

Warne²,

Brent³

et al. 1988

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

204

View full text Add to dashboard Cite

We have isolated a c-erbA cDNA clone from a GH3 cell library. The clone, denoted erb62, is 4.5 kilobases long and encodes a 461-amino acid 3-type c-erbA protein. This c-erbA protein binds 3,5,3'-triiodothyronine (T3) and T3 analogs with affinities similar to those of the authentic T3 receptor. By RNA gel blot analysis, erb62 hybridizes to a 6-kilobase RNA found in organs that express T3 receptors-e.g., heart, kidney, and brain. A COS-cell transient cotransfection system was used to show that erb62 encodes a biologically active T3 receptor. An oligonucleotide, corresponding to a portion of the rat growth hormone gene 5'-flanking region that contains a T3 response element, was inserted on the 5' side of the herpes simplex virus thymidine kinase promoter in a chloramphenicol acetyltransferase-expressing plasmid. Reporter gene expression directed by this hybrid promoter was T3 inducible only if this plasmid was cotransfected with an erb62-expressing plasmid.Thyroid hormone [3,5,3'-triiodothyronine (T3)] exerts diverse metabolic effects in mammalian cells, primarily through its interaction with a nuclear receptor protein. This T3-receptor complex regulates expression of nearby target genes by transcriptional and posttranscriptional mechanisms. The protooncogene c-erbA has been shown to encode a high-affinity T3-binding protein (1)(2)(3)(4). Since this gene product also is similar to certain DNA-binding proteins and since it binds T3 analogs with approximately the same relative affinities as the endogenous T3 receptor, it is presumed that the c-erbA protein is the nuclear T3 receptor. However, this postulate has yet to be supported by functional data. Unexpectedly, at least two c-erbA genes § and mRNAs exist in humans (2, 4). This suggests that more than one class ofT3 receptor protein exists, in contrast to conclusions drawn from biochemical and biophysical data (5). Tissue-specific expression of various T3 receptors could account, in part, for the tissue-specific effects of T3.We have used the rat as a model for studying T3 effects and, in particular, have been interested in the regulation of rat growth hormone (rGH) gene expression by T3 in cultured pituitary cells (6, 7). Therefore, we have isolated and characterized a c-erbA cDNA clone from a rat GH3 cell library. ¶ In a transient cotransfection system, the protein encoded by this cDNA confers T3 responsiveness to a hybrid promoter that contains a T3 response element, thus demonstrating that c-erbA protein is a functional T3 receptor.

show abstract

L6 cells as a tissue culture model for thyroid hormone effects on skeletal muscle metabolism.

Cited by 27 publications

References 20 publications

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes

Thyroid hormone regulates expression of a transfected alpha-myosin heavy-chain fusion gene in fetal heart cells.

Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor.

Contact Info

Product

Resources

About

L6 cells as a tissue culture model for thyroid hormone effects on skeletal muscle metabolism.

Cited by 27 publications

References 20 publications

Quantification of hormone-induced atrophy of large myotubes from C2C12 and L6 cells: atrophy-inducible and atrophy-resistant C2C12 myotubes

Quantification of hormone-induced atrophy of large myotubes from C2C12 and L6 cells: atrophy-inducible and atrophy-resistant C2C12 myotubes

Thyroid hormone regulates expression of a transfected alpha-myosin heavy-chain fusion gene in fetal heart cells.

Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor.

Contact Info

Product

Resources

About

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes

Quantification of hormone-induced atrophy of large myotubes from C₂C₁₂ and L6 cells: atrophy-inducible and atrophy-resistant C₂C₁₂ myotubes