Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5 ' ACA AGTACCGTGAGGGAAAGTTG 3 ' ) and D3B (5 ' TCGGAAGGAACCAGCTACTA 3 ' ). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.