Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5 ' ACA AGTACCGTGAGGGAAAGTTG 3 ' ) and D3B (5 ' TCGGAAGGAACCAGCTACTA 3 ' ). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.
In October 2021, root and soil samples were collected from cabbage (Brassica oleracea var. viridis L.) growing fields in the Black Sea region of Turkiye. Cyst forming nematodes were detected in soil and root samples. Cysts were extracted from soil using Cobb’s sieving method. Obtained nematodes were subjected to morphological and molecular analysis. For molecular analysis, the ribosomal DNA region spanning the internal transcribed spacers (ITS1, 5.8S, ITS2) gene and D2-D3 expansion segments of the 28S ribosomal RNA (rRNA) were amplified using primer sets TW81/AB28 and D2A/D3B, respectively. Also, Cytochrome Oxidase I (cox1) region of mitochondrial DNA (mtDNA) using species-specific primer set (Car-F/Car-R) were used to clarify the identification. PCR product was sequenced and then compared with sequences of Heterodera species available in the GenBank database. The NCBI BLAST analysis of Turkiye population sequences showed 99.82% similarity with Heterodera carotae Jones 1950 sequences registered in GenBank. The newly obtained sequences were submitted to the GenBank database under accession number OP602412.1. The present study includes scanning electron micrographs (SEM) of the external morphology of the cyst cone, second stage juvenile and male. The results obtained from morphological and molecular studies showed that the cysts nematode population was H. carotae. This is the first report of H. carotae detected in Türkiye.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.