Intersectin Regulates Dendritic Spine Development and Somatodendritic Endocytosis but Not Synaptic Vesicle Recycling in Hippocampal Neurons

Thomas, Sébastien; Ritter, Brigitte; Verbich, David; Sanson, Claire; Bourbonnière, Lyne; McKinney, R. Anne; McPherson, Peter S.

doi:10.1074/jbc.m809746200

Cited by 89 publications

(107 citation statements)

References 59 publications

Supporting

Mentioning

100

Contrasting

Unclassified

Order By: Relevance

“…shRNA with a microRNA stem (shRNAmir) was designed against target sequences (see below) for each 14-3-3 isoform using Invitrogen's RNAi Designer. Oligonucleotides encoding the sequences were ligated into a pcDNA6.2-GW/EmGFP-miR vector and lentivirus was produced as described previously (Thomas et al, 2009). Sequences of oligos used for knockdown of each 14-3-3 isoform are as follows: 14-3-3␤, TGCTGATAACGCTCAGCTTGCTCAGCGTTTTGG-CCACTGACTGACGCTGAGCACTGAGCGTTAT; 14-3-3 , TGCTG-ATAAGCAACAGAGAGAAGGTTGTTTTGGCCACTGACTGACAAC-CTTCTCTGTTGCTTAT; 14-3-3␥, TGCTGATCAGAGTGGAGTC-CTTGTAGGTTTTGGCCACTGACTGACCTACAAGGTCCACTCTGAT; 14-3-3 , TGCTGTGAGGGTGCTGTCTTTGTAGGGTTTTGGCCAC-TGACTGACCCTACAAACAGCACCCTCA; 14-3-3 , TGCTGAAACC-TTGGACTCGCCAGTGTGTTTTGGCCACTGACTGACACACTGGC-GTCCAAGGTTT; Control, TGCTGTTTGCAAAGAGCACTTTCT-TTTCCACTACTGACGAAAGCCTTCTCTTGCAAA.…”

Section: Methodsmentioning

confidence: 99%

14-3-3 Proteins Regulate Protein Kinase A Activity to Modulate Growth Cone Turning Responses

Kent¹,

Shimada²,

Ferraro³

et al. 2010

J. Neurosci.

View full text Add to dashboard Cite

Growth cones regulate the speed and direction of neuronal outgrowth during development and regeneration. How the growth cone spatially and temporally regulates signals from guidance cues is poorly understood. Through a proteomic analysis of purified growth cones we identified isoforms of the 14-3-3 family of adaptor proteins as major constituents of the growth cone. Disruption of 14-3-3 via the R18 antagonist or knockdown of individual 14-3-3 isoforms switches nerve growth factor-and myelin-associated glycoproteindependent repulsion to attraction in embryonic day 13 chick and postnatal day 5 rat DRG neurons. These effects are reminiscent of switching responses observed in response to elevated cAMP. Intriguingly, R18-dependent switching is blocked by inhibitors of protein kinase A (PKA), suggesting that 14-3-3 proteins regulate PKA. Consistently, 14-3-3 proteins interact with PKA and R18 activates PKA by dissociating its regulatory and catalytic subunits. Thus, 14-3-3 heterodimers regulate the PKA holoenzyme and this activity plays a critical role in modulating neuronal responses to repellent cues.

show abstract

Section: Methodsmentioning

confidence: 99%

14-3-3 Proteins Regulate Protein Kinase A Activity to Modulate Growth Cone Turning Responses

Kent¹,

Shimada²,

Ferraro³

et al. 2010

J. Neurosci.

View full text Add to dashboard Cite

show abstract

“…A nontargeting miRNA was used for controls, and its sequence is AATTCTCCGAACGTGT-CACGT. Oligonucleotides encoding the miRNA sequences were cloned into pcDNA 6.2-GW/EmGFP-miR plasmid (Invitrogen), and lentivirus was produced as described (29). Virus vectors were generally transduced at 7 days in vitro (DIV), and neurons were processed for immunofluorescence or Western blot at 14 -21 DIV.…”

Section: Methodsmentioning

confidence: 99%

The Clavesin Family, Neuron-specific Lipid- and Clathrin-binding Sec14 Proteins Regulating Lysosomal Morphology

Katoh

Ritter

Gaffry

et al. 2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Clathrin-coated vesicles (CCVs) originating from the transGolgi network (TGN) provide a major transport pathway from the secretory system to endosomes/lysosomes. Herein we describe paralogous Sec14 domain-bearing proteins, clavesin 1/CRALBPL and clavesin 2, identified through a proteomic analysis of CCVs. Clavesins are enriched on CCVs and form a complex with clathrin heavy chain (CHC) and adaptor protein-1, major coat components of TGN-derived CCVs. The proteins co-localize with markers of endosomes and the TGN as well as with CHC and adaptor protein-1. A membrane mimic assay using the Sec14 domain of clavesin 1 reveals phosphatidylinositol 3,5-bisphosphate as a specific lipid partner. Phosphatidylinositol 3,5-bisphosphate is localized to late endosomes/lysosomes, and interestingly, isoform-specific knockdown of clavesins in neurons using lentiviral delivery of interfering RNA leads to enlargement of a lysosome-associated membrane protein 1-positive membrane compartment with no obvious influence on the CCV machinery at the TGN. Since clavesins are expressed exclusively in neurons, this new protein family appears to provide a unique neuron-specific regulation of late endosome/lysosome morphology.

show abstract

“…Moreover, stabilizing scaffolds may aid coupling of SV exo-and endocytosis (1,3). The Drosophila multidomain protein Dap160, an ortholog of mammalian intersectin, has been postulated to act as an endocytic scaffold of the periactive zone (9)(10)(11), although its precise role in SV recycling in mammalian nerve terminals remains largely unclear (12).…”

mentioning

confidence: 99%

Regulation of synaptic vesicle recycling by complex formation between intersectin 1 and the clathrin adaptor complex AP2

Pechstein

Bacetic

Vahedi-Faridi

et al. 2010

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Clathrin-mediated synaptic vesicle (SV) recycling involves the spatiotemporally controlled assembly of clathrin coat components at phosphatidylinositiol (4, 5)-bisphosphate [PI(4,5)P 2 ]-enriched membrane sites within the periactive zone. Such spatiotemporal control is needed to coordinate SV cargo sorting with clathrin/AP2 recruitment and to restrain membrane fission and synaptojanin-mediated uncoating until membrane deformation and clathrin coat assembly are completed. The molecular events underlying these control mechanisms are unknown. Here we show that the endocytic SH3 domaincontaining accessory protein intersectin 1 scaffolds the endocytic process by directly associating with the clathrin adaptor AP2. Acute perturbation of the intersectin 1-AP2 interaction in lamprey synapses in situ inhibits the onset of SV recycling. Structurally, complex formation can be attributed to the direct association of hydrophobic peptides within the intersectin 1 SH3A-B linker region with the "side sites" of the AP2 α-and β-appendage domains. AP2 appendage association of the SH3A-B linker region inhibits binding of the inositol phosphatase synaptojanin 1 to intersectin 1. These data identify the intersectin-AP2 complex as an important regulator of clathrinmediated SV recycling in synapses.endocytosis | synapse | scaffolding proteins | appendage | synaptojanin S ynaptic vesicles (SVs), following their activity-dependent exocytic fusion with the presynaptic plasma membrane, are recycled by compensatory endocytosis at the periactive zone (1-3), largely via clathrin-mediated reinternalization of fully fused SV membrane (4). Clathrin-coated pit (CCP) formation (5) proceeds through the assembly of endocytic proteins at phosphatidylinositiol (4, 5)-bisphosphate [PI(4,5)P 2 ]-enriched membrane sites (6, 7). A key factor in the assembly pathway is the heterotetrameric adaptor complex AP2, whose α-and β2-appendage domains act as major recruitment platforms for accessory proteins (6, 7), regulating distinct steps within the pathway. Despite our extensive knowledge regarding the endocytic interactome, we know comparably little about the structural components within the periactive zone that scaffold the endocytic process, thereby allowing the high fidelity of SV recycling. Such spatiotemporal control is needed to coordinate SV cargo protein sorting with coat recruitment (8) and to restrain membrane fission and uncoating until membrane deformation and CCP assembly are completed. Moreover, stabilizing scaffolds may aid coupling of SV exo-and endocytosis (1, 3). The Drosophila multidomain protein Dap160, an ortholog of mammalian intersectin, has been postulated to act as an endocytic scaffold of the periactive zone (9-11), although its precise role in SV recycling in mammalian nerve terminals remains largely unclear (12).Here we show that intersectin 1 scaffolds the endocytic process by directly associating with AP2. Acute perturbation of intersectin-AP2 complex formation blocks the onset of SV recycling. Moreover, association of the SH3A-B l...

show abstract

Intersectin Regulates Dendritic Spine Development and Somatodendritic Endocytosis but Not Synaptic Vesicle Recycling in Hippocampal Neurons

Cited by 89 publications

References 59 publications

14-3-3 Proteins Regulate Protein Kinase A Activity to Modulate Growth Cone Turning Responses

14-3-3 Proteins Regulate Protein Kinase A Activity to Modulate Growth Cone Turning Responses

The Clavesin Family, Neuron-specific Lipid- and Clathrin-binding Sec14 Proteins Regulating Lysosomal Morphology

Regulation of synaptic vesicle recycling by complex formation between intersectin 1 and the clathrin adaptor complex AP2

Contact Info

Product

Resources

About