Interleukin-10 inhibits interleukin-8 production in human neutrophils

Wang, Peng; Wu, Ping; Anthes, John C.; Siegel, Marvín I.; Egan, Robert W.; Billah, M. Motasim

doi:10.1182/blood.v83.9.2678.2678

Cited by 194 publications

(64 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Oligonucleotide primers were as follows: IL-8 (forward: AG-GAAGCTCACTGGTGGCTG and reverse: TAGGCACAATC-CAGGTGGC); IL-18 (forward: CAAGGAATTGTCTCCCAG-TGC and reverse: CAGCCGCTTTAGCAGCCA); Mip-1␣ (forward: AGCTGACTACTTTGAGACGAGCA and reverse: CG-GCTTCGCTTGGTTAGGA); Mip-1␤ (forward: CTGCTCTC-CAGCGCTCTCA and reverse: GTAAGAAAAGCAGCAGGC-GG); Mip-3␣ (forward: TCCTGGCTGCTTTGATGTCA and reverse: TCAAAGTTGCTTGCTGCTTCTG); Mip-3␤ (forward: GGCACCAATGATGCTGAAGA and reverse: GAAGTTCCT-CACGATGTACCCAG); TNF-␣ (forward: TCTTCTCGAAC-CCCGAGTGA and reverse: CCTCTGATGGCACCACCAG); 18S (forward: AGGAATTGACGGAAGGGCAC and reverse: GGACATCTAAGGGCATCACA). Contaminating PBMC mRNA was undetectable in our neutrophil preparations, as no cDNA could be amplified in RT-PCR using IL-6 primers in samples from LPS-stimulated cells, in agreement with previous studies (10,34).…”

Section: Isolation Of Rna and Real-time Pcr Analysessupporting

confidence: 92%

utocrine role of endogenous interleukin‐18 on inflammatory cytokine generation by human neutrophils

2008

View full text Add to dashboard Cite

Neutrophils are key players of innate immunity and influence inflammatory and immune reactions through the production of numerous cytokines. Interleukin-18 (IL-18) is known to stimulate several neutrophil responses, and recent evidence suggests that neutrophils might represent a source of IL-18. Here, we show that neutrophils constitutively produce both IL-18 and its antagonist, IL-18BP. Cell activation does not affect IL-18BP release but leads to an increased gene expression and secretion of IL-18, a process that depends on NF-kappaB activation. Moreover, endogenous IL-18 feeds back on the neutrophils to augment cytokine generation in lipopolysaccharide-treated cells. Accordingly, exogenous IL-18 can induce the gene expression and release of several inflammatory cytokines in neutrophils, including its own expression. We finally report that IL-18 activates the p38 MAPK, MEK/ERK, and PI3K/Akt pathways in neutrophils. The IKK cascade is also activated by IL-18, resulting in IkappaB-alpha degradation, NF-kappaB activation, and RelA phosphorylation. Accordingly, these pathways contribute to the generation of inflammatory cytokines in IL-18-stimulated neutrophils. By contrast, the phosphorylation and DNA-binding activity of various STAT proteins were not induced by IL-18. Collectively, our results unveil new interactions between IL-18 and neutrophils and further support a role for these cells in influencing both innate and adaptive immunity.

show abstract

Section: Isolation Of Rna and Real-time Pcr Analysessupporting

confidence: 92%

utocrine role of endogenous interleukin‐18 on inflammatory cytokine generation by human neutrophils

2008

View full text Add to dashboard Cite

show abstract

“…IL-10. IL-10 appears in plasma by 1 h after endotoxemia and peaks by 3 h. Both IL-10 and PGE 2 work in part through cAMP pathways to turn off the production of inflammatory mediators in macrophages and PMNs [200][201]. Increases in intracellular cAMP in PMNs is associated with decreased adhesion to epithelial cells [202].…”

Section: Colony-stimulating Factorsmentioning

confidence: 99%

Neutrophil migration during endotoxemia

Wagner

Roth

1999

Journal of Leukocyte Biology

177

125

View full text Add to dashboard Cite

Endotoxemia is marked by a global activation of inflammatory responses, which can lead to shock, multiple organ failure, and the suppression of immune and wound healing processes. Neutrophils (PMNs) play a central role in some of these responses by accumulating in tissues and releasing reactive oxygen species and proteases that injure host structures. This review focuses on altered PMN migratory responses that occur during endotoxemia and their consequences in the development of pulmonary infection. The inflammatory mediators that might be responsible for these altered responses are discussed. The oxidant potential of PMNs is increased after exposure to endotoxin both in vitro and during clinical and experimental endotoxemia. However, other functions such as chemotaxis and phagocytosis are often depressed in these same cells. Endotoxin exposure renders PMNs hyperadhesive to endothelium. The sum of these effects produces activated inflammatory cells that are incapable of leaving the vasculature. As such, the endotoxic PMN is more likely to promote tissue injury from within microvascular beds than to clear pathogens from extravascular sites. Moreover, the functional characteristics of endotoxic PMNs are similar to those observed during trauma, burn injury, sepsis, surgery, and other inflammatory conditions. Accordingly, several clinical conditions might have a common effector in the activated, yet migratorially dysfunctional, PMN. Direct effects of endotoxin on PMNs as well as effects of endogenous mediators released during endotoxemia are discussed. Understanding PMN behavior during endotoxemia may provide basic and critical insights that can be applied to a number of inflammatory scenarios. J. Leukoc. Biol. 66: 10-24; 1999.

show abstract

“…Since the protein synthesis inhibitor cycloheximide antagonizes the protective effects of IL-10, it was suggested that IL-10 may be responsible for the new synthesis of a ribonuclease acting on cytokine transcripts [16]. The ability of IL-10 to decrease mRNA stability has also been shown for a number of cytokines, including IL-6, IL-8, G-CSF, GM-CSF and IL-10 itself [14,15,17,18].…”

Section: Effect On In¯ammatory Cellsmentioning

confidence: 99%