Interallelic complementation at the pyrF locus and the homodimeric nature of orotate phosphoribosyltransferase (OPRTase) in Mucor circinelloides

Abstract

Using 5-fluoroorotic acid (5-FOA) as a positive selection system we isolated mutants of Mucor circinelloides altered in the pyrimidine biosynthetic pathway. These mutants were found to be deficient either in orotidine-5'-monophosphate decarboxylase (OMPdecase), or in orotate phosphoribosyltransferase (OPRTase) activity. Complementation tests among mutants lacking OPRTase activity classified them into three groups, thus suggesting the possibility of interallelic complementation. To investigate this hypothesis a cDNA clone corresponding to the OPRTase-encoding gene of M. circinelloides was isolated by direct complementation of E. coli. The genomic copy transformed to prototrophy one member of each of the three classes of OPRTase-deficient mutants. We therefore concluded that they were all altered at the same locus, the pyrF locus. The corresponding alleles were cloned and sequenced. Comparisons of the amino acid sequence of M. circinelloides OPRTase with those of E. coli and S. typhimurium revealed a high degree of similarity in secondary and tertiary structure. As the two bacterial enzymes exist as dimers, a homodimeric quaternary structure of the M. circinelloides mature protein can be assumed. This would also explain the interallelic complementation between some pyrF mutants. The mutations found could affect either the active site or the structure of the dimer interface of the OPRTase.

Blue-light regulation of phytoene dehydrogenase ( carB ) gene expression in Mucor circinelloides

“…Plasmid pAVB89, carrying both the genomic copy of the gene encoding phytoene dehydrogenase and the gene pyrF (Velayos et al 1998) of M. circinelloides, was used to transform to prototrophy three dierent carB, pyrF mutant strains of M. circinelloides (MS33, MS43 and MS46). As the transformants are obtained as heterokaryons, they were subjected to three cycles of vegetative growth, and a single colony from two dierent transformants of each strain was selected for further analysis.…”

“…The E. coli strains were grown in Luria broth (LB; Sambrook et al 1989), appropriately supplemented. Mucor circinelloides wild-type strain CBS277.49 (CBS; Centraalbureau voor Schimmelcultures, Baarn, The Netherlands) and carB mutants MS33, MS43 and MS46 (Velayos et al 1997(Velayos et al , 1998 were used. Minimal medium YNB [1% glucose, 0.05% yeast nitrogen base without amino acids, 0.15% (NH 4 ) 2 SO 4 , 0.15% glutamic acid] and complete medium YPG [0.3% yeast extract, 1% peptone, 2% glucose] were used and uracil (400 lg ml )1 ) was added when needed.…”

A bifunctional enzyme with lycopene cyclase and phytoene synthase activities is encoded by the carRP gene of Mucor circinelloides

“…Labelling, hybridization and immunological detection were carried out using the digoxigenin (DIG)‐based ‘Nonradioactive labeling and immunological detection kit’ and the ‘PCR DIG labeling mix’ (Roche Molecular Biochemicals) following the supplier's recommendations. Oligonucleotides FSALELOS1 (5′‐GGCGACAGTAGCAATGGCGACGATTTAC‐3′), complementary to nucleotide positions +2215 to +2242 in the 3′ noncoding region of the carRP gene, and FSALELOS2 (5′‐GTGATGGATCAAGGAGCAGCGGCC‐3′), corresponding to positions +138 to +118 of the carB gene, were used for allele amplification under conditions described previously [32], except that the annealing temperature was 68 °C, and 35 cycles were performed. Oligonucleotides FSS1 (5′‐CATTCCACGACCTGTCCG‐3′), positions +915 to +932 of the carRP gene, and FSI1 (5′‐CCTTGACAATGGCTGGGC‐3′), positions +1695 to +1678, were used for probe PCR labelling.…”

Genetic damage following introduction of DNA in Phycomyces

“…Self-replicative transformation seems to prevail, in contrast with the predominance of integrative transformation in other fungi (Fincham, 1989). The best results are obtained with Mucor circinelloides, an obscure organism until it was found that it is transformable at high rates, about 1 transformed colony per ng DNA and 10 6 spheroplasts, and that many of its gene sequences support self replication of plasmids (Benito et al, , 1995Heeswijck and Roncero, 1984;Heeswijck, 1986;Iturriaga et al, 1992;Ruiz-Hidalgo et al, 1999;Velayos et al, 1998). The transformed phenotype is much less frequent and very unstable in Absidia glauca (Burmester, 1995;Burmester et al, 1992;W€ o ostemeyer et al, 1987), Parasitella simplex (Burmester, 1992), Rhizopus niveus (Takaya et al, 1996), Rhizopus oryzae (Skory, 2002), and Phycomyces blakesleeanus (see below).…”