Induction of &amp;#946;-1,3-Glucanase in Seeds of Maize Defective-Kernel Mutant (827Kpro1)

Branco, Alan T.; Ferreira, Beatriz dos Santos; Lourenco, Guinevere F.; Marques, Valeria Cristina Lopes; Machado, Olga Lima Tavares; Pereira, Messias Gonzaga; Almeida, João C.A.; Filho, Gonçalo A. de Souza

doi:10.2174/092986611795446012

Cited by 6 publications

(5 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Comparison between the ZmGns sequences amplified from cDNA and genomic DNA (using primer pairs G113, 5′‐TCATCGATCGATCGACGACCATG‐3′ and G114, 5′‐GGCCCTCAGAATTCTATCTCTTTTTATTCATC‐3′) showed that there is no intron in ZmGns . A new homology search of ZmGns was performed using the full‐length cDNA sequence, which showed that there are at least 10 DNA or EST sequences available in GenBank or MaizeGDB that showed various identities to our ZmGns , including a seed‐specific glucanase cDNA (HM641756, 98.3%) reported by Branco et al (), a genomic DNA clone GRMZM2G125032 (98.3%) from MaizeGDB, as well as several other cDNA or ESTs, such as BT038595 (97.2%), NM_0011112264 (62%), and DQ147109 (53%). Based on DNA sequence identities, GRMZM2G125032 appears to be the genomic clone of HM641756 and our ZmGns shares a higher homology with HM641756/GRMZM2G125032 (21 nucleotide differences at DNA level and three amino acid differences at protein level) than with BT038595/ACF83600 (34 nt differences at DNA level and seven amino acid differences at protein level).…”

Section: Resultsmentioning

confidence: 99%

“…Also, RNA blot and in situ hybridization revealed that the Arabidopsis BG4 gene was specifically expressed in the style and septum of the ovary (Delp and Palva ). A maize glucanase, which shares 99% homology with this ZmGns, was reported to be seed‐specifically expressed (Branco et al ). However, whether this gene was expressed in silk was not examined in the study by Branco et al ().…”

Section: Discussionmentioning

confidence: 99%

“…A maize glucanase, which shares 99% homology with this ZmGns, was reported to be seed‐specifically expressed (Branco et al ). However, whether this gene was expressed in silk was not examined in the study by Branco et al (). In the present study, the expression of ZmGns was constitutively expressed in all tissues examined with the highest level being observed in the silk tissue, indicating its role in normal maize growth and development.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

ZmGns, a maize class I β‐1,3‐glucanase, is induced by biotic stresses and possesses strong antimicrobial activity

Xie

Raruang

Chen

et al. 2014

JIPB

View full text Add to dashboard Cite

Plant β-1,3-glucanases are members of the pathogenesis-related protein 2 (PR-2) family, which is one of the 17 PR protein families and plays important roles in biotic and abiotic stress responses. One of the differentially expressed proteins (spot 842) identified in a recent proteomic comparison between five pairs of closely related maize (Zea mays L.) lines differing in aflatoxin resistance was further investigated in the present study. Here, the corresponding cDNA was cloned from maize and designated as ZmGns. ZmGns encodes a protein of 338 amino acids containing a potential signal peptide. The expression of ZmGns was detectible in all tissues studied with the highest level in silks. ZmGns was significantly induced by biotic stresses including three bacteria and the fungus Aspergillus flavus. ZmGns was also induced by most abiotic stresses tested and growth hormones including salicylic acid. In vivo, ZmGns showed a significant inhibitory activity against the bacterial pathogen Pseudomonas syringae pv. tomato DC3000 and fungal pathogen Botrytis cinerea when it overexpressed in Arabidopsis. Its high level of expression in the silk tissue and its induced expression by phytohormone treatment, as well as by bacterial and fungal infections, suggest it plays a complex role in maize growth, development, and defense.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

ZmGns, a maize class I β‐1,3‐glucanase, is induced by biotic stresses and possesses strong antimicrobial activity

Xie

Raruang

Chen

et al. 2014

JIPB

View full text Add to dashboard Cite

show abstract

“…Chitinases can act on cell walls, and an antifungal effect with positive implications on the germination rate is usually described for these proteins. , However, a role in normal plant growth and development is also admitted since in Arabidopsis alterations in chitinase expression can lead to cell wall malformations and abnormal cell shapes . Although higher chitinase levels were also found in an endosperm development mutant, no correlation between chitinase content and endosperm texture was detected. , …”

Section: Discussionmentioning

confidence: 99%

Two Traditional Maize Inbred Lines of Contrasting Technological Abilities Are Discriminated by the Seed Flour Proteome

Pinheiro

Sergeant²,

Machado

et al. 2013

J. Proteome Res.

View full text Add to dashboard Cite

The seed proteome of two traditional maize inbred lines (pb269 and pb369) contrasting in grain hardness and in preferable use for bread-making was evaluated. The pb269 seeds, of flint type (i.e., hard endosperm), are preferably used by manufacturers, while pb369 (dent, soft endosperm) is rejected. The hypothesis that the content and relative amounts of specific proteins in the maize flour are relevant for such discrimination of the inbred lines was tested. The flour proteins were sequentially extracted following the Osborne fractionation (selective solubilization), and the four Osborne fractions were submitted to two-dimensional electrophoresis (2DE). The total amount of protein extracted from the seeds was not significantly different, but pb369 flour exhibited significantly higher proportions of salt-extracted proteins (globulins) and ethanol-extracted proteins (alcohol-soluble prolamins). The proteome analysis allowed discrimination between the two inbred lines, with pb269 demonstrating higher heterogeneity than pb369. From the 967 spots (358 common to both lines, 208 specific to pb269, and 401 specific to pb369), 588 were submitted to mass spectrometry (MS). Through the combined use of trypsin and chymotrypsin it was possible to identify proteins in 436 spots. The functional categorization in combination with multivariate analysis highlighted the most discriminant biological processes (carbohydrate metabolic process, response to stress, chitin catabolic process, oxidation-reduction process) and molecular function (nutrient reservoir activity). The inbred lines exhibited quantitative and qualitative differences in these categories. Differences were also revealed in the amounts, proportions, and distribution of several groups of storage proteins, which can have an impact on the organization of the protein body and endosperm hardness. For some proteins (granule-bound starch synthase-1, cyclophilin, zeamatin), a change in the protein solubility rather than in the total amount extracted was observed, which reveals distinct in vivo associations and/or changes in binding strength between the inbred lines. Our approach produced information that relates protein content, relative protein content, and specific protein types to endosperm hardness and to the preferable use for "broa" bread-making.

show abstract

“…β-1,3-glucanases are involved in various plant processes, such as overwintering, inflorescence lengthening, male gametophyte development, pollination, seed development and germination, fruit physiology, defence against biotic and abiotic stress, and nutrient uptake from heterotrophic organisms [ 6 , 7 , 8 ]. Specific extracellular β-1,3-glucanases bind to the surface of ice crystals, limiting their growth in the apoplast, thus providing cryoprotection [ 9 , 10 ].…”

Section: Introductionmentioning

confidence: 99%

Basic β-1,3-Glucanase from Drosera binata Exhibits Antifungal Potential in Transgenic Tobacco Plants

Rajninec

Fratrikova

Boszorádová

et al. 2021

Plants

View full text Add to dashboard Cite

The basic β-1,3-glucanase of the carnivorous plant Drosera binata was tested as a purified protein, as well as under the control of a double CaMV35S promoter in transgenic tobacco for its capability to inhibit the growth of Trichoderma viride, Rhizoctonia solani, Alternaria solani, and Fusarium poae in an in-vitro assay. The purified protein inhibited tested phytopathogens but not the saprophytic fungus T. viride. Out of the analysed transgenic plants, lines 13, 16, 19, and 22 exhibited high DbGluc1 transcript abundance normalised to the actin transcript. Because of DbGluc1 transgene expression, lines 13 and 16 showed a 1.7-fold increase and lines 19 and 22 showed more than a 2-fold increase in total β-1,3-glucanase activity compared to the non-transgenic control. In accordance with the purified β-1,3-glucanase in-vitro antifungal assay, crude protein extracts of lines 19 and 22 significantly inhibited the growth of phytopathogens (14–34%). Further analyses revealed that the complementary action of transgenic β-1,3-glucanase and 20% higher activity of endogenous chitinase(s) in these lines were crucial for maximising the antifungal efficiency of crude protein extracts.

show abstract

Induction of β-1,3-Glucanase in Seeds of Maize Defective-Kernel Mutant (827Kpro1)

Cited by 6 publications

References 0 publications

ZmGns, a maize class I β‐1,3‐glucanase, is induced by biotic stresses and possesses strong antimicrobial activity

ZmGns, a maize class I β‐1,3‐glucanase, is induced by biotic stresses and possesses strong antimicrobial activity

Two Traditional Maize Inbred Lines of Contrasting Technological Abilities Are Discriminated by the Seed Flour Proteome

Basic β-1,3-Glucanase from Drosera binata Exhibits Antifungal Potential in Transgenic Tobacco Plants

Contact Info

Product

Resources

About