Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia

Abstract

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia.

Emerging roles of Sox6 in the renal and cardiovascular system

“…(2018), reported that disruption of Sox6 binding domain results in the reactivation of γ globin expression. This study concluded that silencing Sox6 may become therapeutic strategy for β‐thalassemia treatment (Modares Sadeghi et al., 2018; Shariati et al., 2018). Another study showed the functional importance of a number of miRNAs and their target Sox6 in hereditary persistence of fetal hemoglobin deletion type‐2 (HPFH‐2) and Sicilian‐δβ‐thalassemia diseases (Fornari et al., 2017).…”

“…Systemic Sox6 knockout mice do not survive after 14 days of birth due to abnormalities in cardiac and skeletal muscles development. We and others have shown that renin promoter possesses the binding site for Sox6 (Modares Sadeghi et al., 2018), and along with other transcription modulators regulate renin expression (Martinez et al., 2018). Using a loss of function mouse model, in which Sox6 is specifically knockout in renin expressing cells, Sox6 was shown to regulate renin expression and JG recruitment in response to sodium depletion and dehydration (Figure 3; Saleem et al., 2020).…”

Disruption of SOX6 gene using CRISPR/Cas9 technology for gamma‐globin reactivation: An approach towards gene therapy of β‐thalassemia

“…Endogenous loci were amplified using forward (5′ ATATACTGTCCTCAGTTTGGG 3′) and reverse (5′ TGAAGTCCACACATACCCTC 3′) primers. The mutation detection was performed as previously described …”

<p>Nucleic Acid Therapy for β-Thalassemia</p>

“… 57 Using ZFN technology, reactivation of γ-globin is achieved by inducing indel mutation of the SOX6 binding domain, and γ-globin expression increased up to 6 fold. 58 …”