In vitro synergistic activity of fosfomycin in combination with other antimicrobial agents against carbapenem-resistant Klebsiella pneumoniae isolated from patients in a hospital in Thailand

Chukamnerd, Arnon; Pomwised, Rattanaruji; Phoo, May Thet Paing; Terbtothakun, Pawarisa; Hortiwakul, Thanaporn; Charoenmak, Boonsri; Chusri, Sarunyou

doi:10.1016/j.jiac.2020.11.004

Cited by 9 publications

(10 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This demonstrates the role of a multi-target mechanism in the management of antibiotic-resistant pathogens. Similar findings were reported for combination therapies of fosfomycin and aminoglycosides (amikacin or gentamicin) against MDR bacterial isolates including Klebsiella pneumoniae, Pseudomonas aeruginosa, and Escherichia coli [20,47,48]. Aminoglycosides generally inhibit protein synthesis by binding to the A-site on the 16S ribosomal RNA of the 30S ribosome [49], whereas fosfomycin inhibits the MurA enzyme and UDP-N-acetylglucosamine-enolpyruvyltransferase, involved in peptidoglycan synthe-sis [50].…”

Section: Discussionsupporting

confidence: 70%

“…The MIC values of fosfomycin decreased two-to fourfold, while uptake of ethidium bromide increased in the presence of CCCP. Previous studies have reported reductions in MIC values in the presence of CCCP as a positive indicator of efflux pump-mediated resistance [20,45,46]. Carbonyl cyanide 3-chlorophenyl hydrazone is a known proton motive force and resistance-nodulation-division efflux pump inhibitor that promotes the transport of molecules across the bacteria membrane.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Evaluation of the Synergistic Antibacterial Effects of Fosfomycin in Combination with Selected Antibiotics against Carbapenem–Resistant Acinetobacter baumannii

2021

Self Cite

View full text Add to dashboard Cite

The spread of multi-drug resistant (MDR) pathogens and the lagging pace in the development of novel chemotherapeutic agents warrant the use of combination therapy as a reliable, cost-effective interim option. In this study, the synergistic effects of fosfomycin in combination with other antibiotics were assessed. Of the 193 isolates, 90.6% were non-susceptible to fosfomycin, with minimum inhibitory concentrations (MICs) of ≥128 µg/mL. Antibacterial evaluation of fosfomycin-resistant isolates indicated multi-drug resistance to various antibiotic classes. Combinations of fosfomycin with 12 commonly used antibiotics synergistically inhibited most fosfomycin-resistant isolates. The fractional inhibitory concentration index indicated that combining fosfomycin with either aminoglycosides, glycylcyclines, fluoroquinolones, or colistin resulted in 2- to 16-fold reduction in the MIC of fosfomycin. Time-kill kinetics further confirmed the synergistic bactericidal effects of fosfomycin in combination with either amikacin, gentamicin, tobramycin, minocycline, tigecycline, or colistin, with more than 99.9% reduction in bacterial cells. Fosfomycin-based combination therapy might serve as an alternative option for the treatment of MDR A. baumannii. Further steps including in vivo efficacy and toxicity in experimental models of infection are required prior to clinical applications.

show abstract

Section: Discussionsupporting

confidence: 70%

Section: Discussionmentioning

confidence: 99%

Evaluation of the Synergistic Antibacterial Effects of Fosfomycin in Combination with Selected Antibiotics against Carbapenem–Resistant Acinetobacter baumannii

2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…13 The bla NDM gene was detected among these CREC isolates by a PCR method using the NDM-F primer (GGTTTGGCGATCTGGTTTTC) and the NDM-R primer (CGGAATGGCTCATCACGATC). 10 , 14 The PCR products were then checked using agarose gel electrophoresis and the expected size was 621 bp. In addition, the MIC values of other 9 antibiotics (fosfomycin, ciprofloxacin, doripenem, levofloxacin, tigecycline, sitafloxacin, colistin, gentamicin, and amikacin) and 1 β-lactamase inhibitor (sulbactam) (Sigma-Aldrich) were evaluated against bla NDM -harboring isolates by the broth microdilution method, according to the Clinical and Laboratory Standards Institute (CLSI) guidelines, 2016 or US Food and Drug Administration (FDA) breakpoints for tigecycline or European Committee on Antimicrobial Susceptibility Testing (EUCAST) for colistin.…”

Section: Methodsmentioning

confidence: 99%

“…However, many studies suggested that fosfomycin should be combined with other antibiotics to avoid the fosfomycin resistance that might be rapidly developed during the therapy. 10 , 11 Additionally, there are few studies reporting the fosfomycin-based combination against bla NDM-1 -harboring CREC. Thus, the objective of this study was to assess the synergistic activities of fosfomycin in combination with other antimicrobial agents against bla NDM-1 -harboring CREC, and to genetically characterize the entire genome of these pathogens.…”

Section: Introductionmentioning

confidence: 99%

In vitro Synergistic Activities of Fosfomycin in Combination with Other Antimicrobial Agents Against Carbapenem-Resistant Escherichia coli Harboring blaNDM-1 on the IncN2 Plasmid and a Study of the Genomic Characteristics of These Pathogens

Kaewnirat¹,

Chuaychob²,

Chukamnerd³

et al. 2022

IDR

Self Cite

View full text Add to dashboard Cite

Purpose The spread of New Delhi metallo-β-lactamase (NDM) encoded by the bla NDM gene has been a global health crisis for many years. Most of bla NDM -harboring bacteria commonly carry various antimicrobial resistance (AMR) genes on their chromosomes or plasmids, leading to limited treatment options. Thus, we aimed to evaluate the synergistic effects of fosfomycin in combination with other antimicrobial agents against bla NDM -harboring carbapenem-resistant Escherichia coli (CREC) and to characterize the whole-genome and plasmid sequences of these pathogens. Methods Thirty-eight CREC isolates were collected from patients in the Medicine Ward, Songklanagarind Hospital, Thailand. The activity of fosfomycin in combination with other antimicrobial agents against CREC isolates harboring bla NDM on the plasmid was evaluated using the checkerboard method. In this method, the serial dilutions of two antibiotics were mixed with the cultured CREC, the mixtures were incubated, and FICI was calculated to interpret the synergistic activity of the combination. The whole-genome and particular plasmids of these pathogens were sequenced using next-generation sequencing. Sequence analysis, especially on antimicrobial resistance (AMR) genes, mobile-genetic elements (MGEs), and virulence genes was performed using many bioinformatics tools. Results Of the E. coli 38 isolates, only 3 isolates contained the bla NDM-1 gene, which is located on the IncN2 plasmid. The combinations of fosfomycin with aminoglycosides, colistin, tigecycline, sitafloxacin, and ciprofloxacin were synergies against bla NDM-1 -harboring CREC isolates. Genomic analysis revealed that these isolates harbored many β-lactam resistance genes and other AMR genes that may confer resistance to aminoglycoside, fluoroquinolone, rifampicin, trimethoprim, sulfonamide, tetracycline, and macrolide. Also, various MGEs, especially the bla NDM-1 -bearing IncN2 plasmid, were present in these isolates. Conclusion Our study demonstrated some synergistic effects of antimicrobial combination against CREC isolates harboring bla NDM-1 on the IncN2 plasmid. Also, our data on the whole-genome and plasmid sequences might be beneficial in the control of the spread of bla NDM-1 -harboring CREC isolates. The linkages between bla NDM-1 -carrying plasmid, patient information, and time of collection will be elucidated to track the horizontal gene transfer in the future.

show abstract

“…Hence, combining existing antimicrobial agents has become a strategy against several kinds of infections caused by multi-drug resistant (MDR) organisms [ 21 ]. Previous studies have supported the use of combination therapy as an effective treatment option for infections caused by several MDR Gram-negative bacteria [ 22 , 23 , 24 ]. A recent study demonstrated the synergistic effect of meropenem and aminoglycosides against KPC-2 and NDM-1-producing carbapenem-resistant Klebsiella pneumoniae [ 25 ].…”

Section: Introductionmentioning

confidence: 99%

Synergistic Antibacterial Effects of Meropenem in Combination with Aminoglycosides against Carbapenem-Resistant Escherichia coli Harboring blaNDM-1 and blaNDM-5

et al. 2021

Self Cite

View full text Add to dashboard Cite

Infections due to carbapenem-resistant Escherichia coli (CREC) are problematic due to limitation in treatment options. Combination therapies of existing antimicrobial agents have become a reliable strategy to control these infections. In this study, the synergistic effects of meropenem in combination with aminoglycosides were assessed by checkerboard and time-kill assays. Of the 35 isolates, 19 isolates (54.3%) were resistant to carbapenems (imipenem and meropenem) with the MIC ranges from 16 to 128 µg/mL. These isolates were resistant to almost all antibiotic classes. Molecular characteristics revealed co-harboring of carbapenemase (blaNDM-1, blaNDM-5 and blaOXA-48) and extended-spectrum β-lactamases (ESBL) genes (blaCTX-M, blaSHV and blaTEM). The checkerboard assay displayed synergistic effects of meropenem and several aminoglycosides against most CREC isolates. Time-kill assays further demonstrated strong synergistic effects of meropenem in combination with either amikacin, gentamicin, kanamycin, streptomycin, and tobramycin. The results suggested that meropenem in combination with aminoglycoside therapy might be an efficient optional treatment for infections cause by CREC.

show abstract

In vitro synergistic activity of fosfomycin in combination with other antimicrobial agents against carbapenem-resistant Klebsiella pneumoniae isolated from patients in a hospital in Thailand

Cited by 9 publications

References 44 publications

Evaluation of the Synergistic Antibacterial Effects of Fosfomycin in Combination with Selected Antibiotics against Carbapenem–Resistant Acinetobacter baumannii

Evaluation of the Synergistic Antibacterial Effects of Fosfomycin in Combination with Selected Antibiotics against Carbapenem–Resistant Acinetobacter baumannii

In vitro Synergistic Activities of Fosfomycin in Combination with Other Antimicrobial Agents Against Carbapenem-Resistant Escherichia coli Harboring blaNDM-1 on the IncN2 Plasmid and a Study of the Genomic Characteristics of These Pathogens

Synergistic Antibacterial Effects of Meropenem in Combination with Aminoglycosides against Carbapenem-Resistant Escherichia coli Harboring blaNDM-1 and blaNDM-5

Contact Info

Product

Resources

About