In vitro inhibition of the replication of classical swine fever virus by porcine Mx1 protein

He, Danni; Zhang, Xiaomin; Liu, Ke; Pang, Ran; Zhao, Jin; Zhou, Bin; Pu-yan, Chen

doi:10.1016/j.antiviral.2014.01.020

Cited by 36 publications

(48 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…poMx1 is a key mediator of the interferon-induced antiviral response against a wide range of viruses, such as vesicular stomatitis virus (VSV) [13], classical swine fever virus (CSFV) [14], and influenza A virus [12]. The combination of the IRES and poMx1 is of interest because it allows steady expression of an antiviral ISG and low expression of IFN.…”

Section: Discussionmentioning

confidence: 99%

“…PoMx1 is also a member of the human MxA-like subgroup according to its sequence similarity to human MxA, which has broad antiviral activity against several viruses [10,11]. These two proteins are both localized in the cytoplasm and have an overlapping antiviral spectrum against different types of viruses including influenza A virus [12], vesicular stomatitis virus (VSV) [13] and classical swine fever virus (CSFV) [14]. The poMx1 system was known to be a fundamental component of ISGs.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Expression of porcine Mx1 with FMDV IRES enhances the antiviral activity against foot-and-mouth disease virus in PK-15 cells

et al. 2015

View full text Add to dashboard Cite

Foot-and-mouth disease virus (FMDV) is the most contagious pathogen in cloven-hoofed (two-toed) animals. Due to the rapid replication and spread of FMDV, novel therapeutic strategies are greatly needed to reduce or block FMDV shedding in cases of disease outbreak. Here, we generated an IRES-Mx1 construct in which the internal ribosome entry site (IRES) of FMDV was inserted between the promoter and open reading frame (ORF) of porcine myxovirus resistance protein 1 (poMx1). This construct provides more powerful protection against FMDV infection than the IRES-IFN construct that was previously generated by our group. The results indicate that this IRES-Mx1 construct was able to express poMx1 12 h after transfection and induce a robust immune response. In contrast to the control, the proliferation of virus in transfected cells was significantly inhibited, as evaluated by morphology monitoring, real-time RT-PCR, virus titration and Western blot. In addition, we also found that the antiviral activity in cells transfected with pc-IRES-Mx1 was abolished when the JAK/STAT pathway was repressed, which indicates that the antiviral mechanism of poMx1 is JAK/STAT pathway dependent. Taken together, our data suggest that the antiviral activity of poMx1 is possibly produced by affecting the host cells themselves, instead of interacting with the virus directly. The new construct reported here could be used as a novel effective therapy against FMDV infection.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Expression of porcine Mx1 with FMDV IRES enhances the antiviral activity against foot-and-mouth disease virus in PK-15 cells

et al. 2015

View full text Add to dashboard Cite

show abstract

“…The siRNAs used in study were siCHC (AACCUGCGGUCUGGAGUCAAC) for the clathrin heavy chain (CHC) (37) and siCav (CACACAGUUUCGAUGGCAUC UTT) for caveolin-1 (38); siRNA for Rab5 (siRab5) (catalog number sc-36344), siRab7 (catalog number sc-29460), and the negative control (catalog number sc-37007) were obtained from Santa Cruz Biotechnology. At 48 h posttransfection, cells were infected with CSFV at an MOI of 0.05, and CSFV replication was then either quantitated by RT-qPCR or examined by confocal microscopy using a mouse anti-CSFV monoclonal antibody (WH303) as described previously (35). CSFV infection was analyzed in at least 300 transfected cells in three independent experiments.…”

Section: Methodsmentioning

confidence: 99%

“…At 24 h postinfection (hpi), cells were lysed by three freeze-thaw cycles. Total RNA was extracted by using TRIzol reagent (Invitrogen, USA), and the viral RNA level was quantitated by using a reverse transcription-quantitative real-time PCR (RT-qPCR) assay as described previously (35). Data are presented as 2 Ϫ⌬⌬CT values from quadruplicate samples.…”

Section: Methodsmentioning

confidence: 99%

Entry of Classical Swine Fever Virus into PK-15 Cells via a pH-, Dynamin-, and Cholesterol-Dependent, Clathrin-Mediated Endocytic Pathway That Requires Rab5 and Rab7

Shi

Liu

Zhou

et al. 2016

J Virol

Self Cite

View full text Add to dashboard Cite

Classical swine fever virus (CSFV), a member of the genus Pestivirus within the family Flaviviridae, is a small, enveloped, positive-strand RNA virus. Due to its economic importance to the pig industry, the biology and pathogenesis of CSFV have been investigated extensively. However, the mechanisms of CSFV entry into cells are not well characterized. In this study, we used systematic approaches to dissect CSFV cell entry. We first observed that CSFV infection was inhibited by chloroquine and NH 4 Cl, suggesting that viral entry required a low-pH environment. By using the specific inhibitor dynasore, or by expressing the dominant negative (DN) K44A mutant, we verified that dynamin is required for CSFV entry. CSFV particles were observed to colocalize with clathrin at 5 min postinternalization, and CSFV infection was significantly reduced by chlorpromazine treatment, overexpression of a dominant negative form of the EPS15 protein, or knockdown of the clathrin heavy chain by RNA interference. These results suggested that CSFV entry depends on clathrin. Additionally, we found that endocytosis of CSFV was dependent on membrane cholesterol, while neither the overexpression of a dominant negative caveolin mutant nor the knockdown of caveolin had an effect. These results further suggested that CSFV entry required cholesterol and not caveolae. Importantly, the effect of DN mutants of three Rab proteins that regulate endosomal traffic on CSFV infection was examined. Expression of DN Rab5 and Rab7 mutants, but not the DN Rab11 mutant, significantly inhibited CSFV replication. These results were confirmed by silencing of Rab5 and Rab7. Confocal microscopy showed that virus particles colocalized with Rab5 or Rab7 during the early phase of infection within 45 min after virus entry. These results indicated that after internalization, CSFV moved to early and late endosomes before releasing its RNA. Taken together, our findings demonstrate for the first time that CSFV enters cells through the endocytic pathway, providing new insights into the life cycle of pestiviruses. IMPORTANCEBovine viral diarrhea virus (BVDV), a single-stranded, positive-sense pestivirus within the family Flaviviridae, is internalized by clathrin-dependent receptor-mediated endocytosis. However, the detailed mechanism of cell entry is unknown for other pestiviruses, such as classical swine fever (CSF) virus (CSFV). CSFV is the etiological agent of CSF, a highly contagious disease of swine that causes numerous deaths in pigs and enormous economic losses in China. Understanding the entry pathway of CSFV will not only advance our knowledge of CSFV infection and pathogenesis but also provide novel drug targets for antiviral intervention. Based on this objective, we used systematic approaches to dissect the pathway of entry of CSFV into PK-15 cells. This is the first report to show that the entry of CSFV into PK-15 cells requires a low-pH environment and involves dynamin-and cholesteroldependent, clathrin-mediated endocytosis that requires Rab5 and Rab7....

show abstract

“…Mx protein is a member of GTPase dynamin superfamily, it can closely interact with ribonucleoprotein (RNP) complex and thus change the confi guration of Mx, which in turn activates its GTPase activity to inhibit the reproduction of the virus by interfering with RNA replication, viral protein synthesis, or transfer of the newly synthesized viral proteins, and thus fi nally exert anti-viral eff ects (Haller et al, 2011). Previous studies have shown that Mx has a broadspectum anti-viral eff ects, it can inhibit the replication of RNA viruses and DNA viruses, including Orthmyxoviruses, Togaviruses, Paramyxoviruses, Rhabdoviruses and Bunyaviruses (Stertz et al, 2007;Fernández-Trujillo et al, 2013;Mitchell et al, 2013;He et al, 2014;Hoenen et al, 2014;Patzina et al, 2014).…”

Section: Introductionmentioning

confidence: 99%

Bovine Mx1 enables resistance against foot-and-mouth disease virus in naturally susceptible cells by inhibiting the replication of viral RNA

Hm¹,

Xz²,

Gx³

et al. 2016

View full text Add to dashboard Cite

Summary. -Innate immunity, especially the anti-viral genes, exerts an important barrier function in preventing viral infections. Myxovirus-resistant (Mx) gene take an anti-viral role, whereas its eff ects on foot-andmouth disease virus (FMDV) in naturally susceptible cells are still unclear. Th e bovine primary fetal tracheal epithelial cell line BPTE-siMx1, in which bovine Mx1 gene was silenced, was established and treated with IFN alpha for 6 hr before FMDV infection. Th e copy numbers of the negative and positive strand viral RNA were determined by strand-specifi c real-time fl uorescence quantitative RT-PCR. Th e TCID 50 of BPTE-siMx1 cells increased at least 17-fold as compared to control cells BPTE-LacZ at 8 hr post infection, thus silencing of bovine Mx1 could promote the replication of FMDV. Th e amount of both the negative and positive strand viral RNA in BPTE-siMx1 cells signifi cantly increased as compared to BPTE-LacZ cells, indicating that the replication levels of viral RNA were promoted by silencing bovine Mx1. Th e bovine Mx1 gene could provide resistance against FMDV in the bovine primary fetal tracheal epithelial cells via suppressing the replication of viral RNA.Keywords: bovine Mx1 gene; foot-and-mouth disease virus; bovine primary fetal tracheal epithelial cell; anti-viral eff ects 1 *Corresponding authors: E-mail: xiaxianzhu@gmail.com, huguixue901103@163.com, hongbinh@hotmail.com; phone: 0086-431-8698-5516, 0086-431-8453-3482, 0086-531-88679268 Abbreviations: FMD = foot-and-mouth disease; FMDV = FMDvirus; IFN = interferon; Mx = myxovirus-resistant; OIE = Offi ce International des Epizooties; RNP = ribonucleoprotein; ssqRT-PCR = strand-specifi c real-time fl uorescence quantitative RT-PCR; TCID 50 = 50% tissue culture infective dose

show abstract

In vitro inhibition of the replication of classical swine fever virus by porcine Mx1 protein

Cited by 36 publications

References 29 publications

Expression of porcine Mx1 with FMDV IRES enhances the antiviral activity against foot-and-mouth disease virus in PK-15 cells

Expression of porcine Mx1 with FMDV IRES enhances the antiviral activity against foot-and-mouth disease virus in PK-15 cells

Entry of Classical Swine Fever Virus into PK-15 Cells via a pH-, Dynamin-, and Cholesterol-Dependent, Clathrin-Mediated Endocytic Pathway That Requires Rab5 and Rab7

Bovine Mx1 enables resistance against foot-and-mouth disease virus in naturally susceptible cells by inhibiting the replication of viral RNA

Contact Info

Product

Resources

About