Identity of the Residues Responsible for the Species-restricted Complement Inhibitory Function of Human CD59

Abstract

The membrane-anchored glycoprotein CD59 inhibits assembly of the C5b-9 membrane attack complex (MAC) of human complement. This inhibitory function of CD59 is markedly selective for MAC assembled from human complement components C8 and C9, and CD59 shows little inhibitory function toward MAC assembled from rabbit and many other non-primate species. We have used this species selectivity of CD59 to identify the residues regulating its complement inhibitory function: cDNA of rabbit CD59 was cloned and used to express human/rabbit CD59 chimeras in murine SV-T2 cells. Plasma membrane expression of each CD59 chimera was quantified by use of a 5-TAG peptide epitope, and each construct was tested for its ability to inhibit assembly of functional MAC from human versus rabbit C8 and C9. These experiments revealed that the species selectivity of CD59 is entirely determined by sequence contained between residues 42 and 58 of the human CD59 polypeptide, whereas chimeric substitution outside this peptide segment has little effect on the MAC inhibitory function of CD59. Substitution of human CD59 residues 42-58 into rabbit CD59 resulted in a molecule that was functionally indistinguishable from native human CD59, whereas the complementary construct (corresponding residues of rabbit CD59 substituted into human CD59) was functionally indistinguishable from rabbit CD59. Based on the solved solution structure of CD59, these data suggest that selectivity for human C8 and C9 resides in a cluster of closely spaced side chains on the surface of CD59 contributed by CD59 is a 77-residue glycosylphosphatidylinositol (GPI) 1 -anchored plasma membrane glycoprotein that serves to protect human blood and vascular cells from injury by the C5b-9 components of the complement system present in plasma (1-6). The complement inhibitory function of CD59 resides in its capacity to interrupt formation of lytic pores in the plasma membrane by binding to segments of the C8␣ and C9 polypeptides that become exposed during their assembly into the complement C5b-9 membrane attack complex (MAC) (7-13). The amino acid sequence and solution structure of CD59 conform to those of the Ly6/cardiotoxin protein superfamily in which five internal disulfide bonds stabilize the polypeptide into a discoid structure consisting of a three-stranded ␤-sheet apposed to a two-stranded ␤-finger (14 -17). In CD59, the GPI anchor is attached to the C-terminal Asn 77 , and Asn 18 provides a single site of N-linked glycosylation (14,15,18). Whereas the carbohydrate attached to Asn 18 occludes most of one face of the discoid surface of the protein, these glycosidic residues do not contribute to the MAC inhibitory properties of CD59 (14, 15, 18 -20). This suggests that amino acid side chains exposed on the non-glycosylated face of the protein provide this function.The complement inhibitory function of CD59 exhibits marked selectivity for MAC assembled from C8 and C9 of human or primate origin, and CD59 shows little inhibitory function toward these same complement components of rabbi...

Application of a novel inhibitor of human CD59 for the enhancement of complement-dependent cytolysis on cancer cells

“…However, 50% of NHL patients are unresponsive to rituximab or resistant after therapy. 25 Extensive evidence indicates that the high expression of mCRPs on the cancer cells influences the efficacy of the rituximab-mediated CDC effect. 39 Consistently, we also demonstrated that the high level of CD59 expression was the major cause of lymphoma resistance to rituximab.…”

“…17,18,[25][26][27][28][29] Recently, we developed a novel, potent, non-toxic and specific antihCD59 inhibitor: the domain 4 of intermedilysin (ILY). This inhibitor is defined as rILYd4.…”

Identification and Functional Characterization of a New Gene Encoding the Mouse Terminal Complement Inhibitor CD59

“…Subsequently, plasmids encoding cd59b and cd59a proteins containing a FLAG peptide tag (DYKDDDDK) were constructed to help visualize surface expression of the proteins by indirect immunofluorescence using a FLAG-specific Ab. A similar approach involving N-terminal peptide tagging has been successfully used in previous functional studies of human CD59 (26,27). The FLAG sequence (encoded by a 24-nucleotide sequence GACTACAAGGACGACGATGACAAG) was inserted into the coding region of cd59b or cd59a (after the second amino acid (lysine) in the predicted mature cd59b protein, or after the second amino acid (threonine) in the mature cd59a protein) to yield Nterminal tagged cd59 proteins after cleavage of the signal peptides.…”

Ly-6I, a New Member of the Murine Ly-6 Superfamily with a Distinct Pattern of Expression

“…Human homologues were first recognized with the identification of CD59, which has a well characterized role as an inhibitor of the complement membrane attack complex (11)(12)(13). Certainly, CD59 homologues have been characterized in rabbit (14), rat (15), pig (16), and mouse (17). At the present time human homologues for several mouse Ly-6SF members are known, including ThB (18), Ly-6H (19), and TSA-1/Sca-2/RIG-E (20,21).…”