Identification of thermo tolerant lactic acid bacteria isolated from silage prepared in the hot and humid climate of Southwestern Japan

Abstract

To develop high-quality silage starters adapted to hot and humid weather, 12 LAB isolates from silage produced in Kyushu and Okinawa, Japan were characterized based on their morphological features, growth curves and sugar utilization. In addition, the nucleotide sequences of the V2-V3 region of their 16S rRNA genes and the 16S-23S rRNA intergenic spacer (ITS) regions were determined. The isolates were also subjected to RAPD-PCR analysis, DNA-DNA hybridization, G+C content analysis and immuno-identification using species-specific monoclonal antibodies and SDS-PAGE profiling. Nearly all of the isolates exhibited high thermotolerance and rapid growth. Combining ITS sequence analysis, RAPD-PCR and immuno-identification enabled rapid and accurate identification of closely related LAB strains that other methods failed to appropriately differentiate; for example, L. plantarum was distinguished from L. pentosus, and L. casei was distinguished from L. rhamonsus. Using the aforementioned techniques, the isolated strains were identified as L. plantarum, L. rhamonsus, L. rapi, Pediococcus pentosaceus and P. lolii. Our findings also showed that there is greater diversity among thermophilic LABs in silage prepared in a hot and humid environment.

Lactic acid bacteria diversity in corn silage produced in Minas Gerais (Brazil)

“…All the LAB species found in the evaluated silages were previously associated with silages from corn or other plants produced at different locations, including warm and tropical regions (Parvin and Nishino 2009;Doi et al 2013;Zhou et al 2016). Of the 11 isolated species two presented homofermentative m et abolism, three obligat el y heterofermentative metabolism and six species with facultatively heterofermentative metabolism.…”

Effects of Lactobacillus buchneri isolated from tropical maize silage on fermentation and aerobic stability of maize and sugarcane silages

“…Doi et al. () analysed the nucleotide sequences of the V2‐V3 region of 16S rRNA, 16S‐23S rRNA intergenic spacer regions, RAPD‐PCR, DNA–DNA hybridization, G+C content and immuno‐identification of silage microorganisms. According to these authors, it was still not possible to distinguish some phylogenetically closely related species, such as L. plantarum, L. paraplantarum and L. pentosus ; L. casei , L. paracasei and L. rhanmosus ; and L. buchneri , L. kefiri , L. parabuchneri and L. rapi .…”

Lactic acid bacteria isolated from fermented flour of finger millet, its probiotic attributes and bioactive properties

“…Polymerase chain reaction (PCR) was performed using Dr. Max DNA Polymerase in a DNA Engine Tetrad 2 Peltier Thermal Cycler (BIO-RAD, UK) under the following conditions: initial denaturation (95°C, 5 min) followed by 35 cycles of denaturation (95°C, 30 s), annealing (55°C, 30 s), initial elongation (72°C, 1 min), and final elongation (72°C, 10 min). The universal primers 27F (5′AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′GGTTACCTTGTTACGACTT3′) were used in PCR (Doi et al 2013), and the PCR product purification was carried out using multiscreen-PCR filter plate (Millipore, USA). The 16S ribosomal RNA gene of the purified DNA products was sequenced at Macrogen, South Korea.…”